Incidental Mutation 'R4765:Cpsf2'
ID 366081
Institutional Source Beutler Lab
Gene Symbol Cpsf2
Ensembl Gene ENSMUSG00000041781
Gene Name cleavage and polyadenylation specific factor 2
Synonyms 100kDa, Cpsf, 2610024B04Rik
MMRRC Submission 042406-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R4765 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 101942247-101972683 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101963699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 476 (Y476C)
Ref Sequence ENSEMBL: ENSMUSP00000047797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047357]
AlphaFold O35218
Predicted Effect probably damaging
Transcript: ENSMUST00000047357
AA Change: Y476C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047797
Gene: ENSMUSG00000041781
AA Change: Y476C

DomainStartEndE-ValueType
Lactamase_B 17 223 5.22e-1 SMART
Beta-Casp 243 368 1.8e-21 SMART
coiled coil region 380 418 N/A INTRINSIC
Pfam:RMMBL 527 569 1.2e-14 PFAM
Pfam:CPSF100_C 608 779 5.7e-46 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,771,987 (GRCm39) R490C probably benign Het
Abcb11 A T 2: 69,076,211 (GRCm39) F1166I probably damaging Het
Acta2 T C 19: 34,223,552 (GRCm39) D181G probably damaging Het
Adgrv1 A G 13: 81,255,038 (GRCm39) I6195T probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ankfy1 T G 11: 72,603,117 (GRCm39) S49A probably benign Het
Azi2 A T 9: 117,890,539 (GRCm39) probably benign Het
Bend3 A T 10: 43,386,746 (GRCm39) S380C probably damaging Het
Bicc1 T C 10: 70,776,423 (GRCm39) T759A probably damaging Het
Cdh10 G T 15: 19,013,364 (GRCm39) V655L probably damaging Het
Cdkn2aip C A 8: 48,166,582 (GRCm39) W75L probably damaging Het
Cenpj G A 14: 56,787,002 (GRCm39) R192* probably null Het
Cflar T C 1: 58,771,480 (GRCm39) S203P probably damaging Het
Chd6 A T 2: 160,808,164 (GRCm39) C1683* probably null Het
Cyp4a12a A G 4: 115,183,388 (GRCm39) D169G possibly damaging Het
D430041D05Rik T A 2: 104,044,441 (GRCm39) R1536S probably damaging Het
Depdc5 A C 5: 33,094,979 (GRCm39) D752A probably damaging Het
Dnah9 C T 11: 65,818,552 (GRCm39) G78D probably damaging Het
Drc1 G T 5: 30,506,075 (GRCm39) Q249H probably benign Het
Drg1 T C 11: 3,200,280 (GRCm39) I364V probably benign Het
Dtymk T C 1: 93,720,631 (GRCm39) H130R probably damaging Het
Elac2 T G 11: 64,883,048 (GRCm39) F140V probably damaging Het
Enpp2 A G 15: 54,739,068 (GRCm39) V353A possibly damaging Het
Fat2 T C 11: 55,172,013 (GRCm39) D2900G probably damaging Het
Fermt2 G T 14: 45,699,693 (GRCm39) T536K probably benign Het
Foxj2 G T 6: 122,810,230 (GRCm39) Q196H probably benign Het
Gadl1 A G 9: 115,795,381 (GRCm39) K328R probably null Het
Gata6 A G 18: 11,054,394 (GRCm39) T108A probably benign Het
Gm16503 G T 4: 147,625,554 (GRCm39) G16V unknown Het
Gpr37 T G 6: 25,669,107 (GRCm39) E579A probably damaging Het
Gps2 T C 11: 69,807,187 (GRCm39) probably benign Het
Hcn4 A T 9: 58,765,260 (GRCm39) I581F unknown Het
Hfm1 T A 5: 106,990,405 (GRCm39) Y1335F probably benign Het
Igsf10 A T 3: 59,237,126 (GRCm39) S1018R probably benign Het
Katnal2 C T 18: 77,065,239 (GRCm39) probably null Het
Kctd8 T C 5: 69,498,191 (GRCm39) K152E possibly damaging Het
Lrp8 T C 4: 107,711,592 (GRCm39) C459R probably damaging Het
Ly6l A T 15: 75,321,543 (GRCm39) I48L probably benign Het
Megf10 A T 18: 57,420,866 (GRCm39) I835F possibly damaging Het
Mei1 A T 15: 81,996,686 (GRCm39) I946F possibly damaging Het
Mrtfb C A 16: 13,230,458 (GRCm39) P1048T probably damaging Het
Myo7b G C 18: 32,094,953 (GRCm39) L1881V probably benign Het
Nfkbiz T C 16: 55,639,387 (GRCm39) probably null Het
Or4b13 T A 2: 90,082,807 (GRCm39) Y175F probably damaging Het
Or5b24 T C 19: 12,912,440 (GRCm39) C113R possibly damaging Het
Pcdhgc5 T C 18: 37,955,122 (GRCm39) S799P probably benign Het
Plk4 A G 3: 40,756,457 (GRCm39) E97G probably damaging Het
Pole2 A T 12: 69,268,826 (GRCm39) H114Q possibly damaging Het
Rad9a C A 19: 4,250,488 (GRCm39) V109L probably benign Het
Scn8a A G 15: 100,938,352 (GRCm39) H1917R probably benign Het
Scyl2 C T 10: 89,495,160 (GRCm39) V304I probably damaging Het
Serpina3f G C 12: 104,185,690 (GRCm39) E298D probably benign Het
Shoc2 A G 19: 53,976,734 (GRCm39) E208G probably benign Het
Sin3a G A 9: 57,004,087 (GRCm39) V280I probably benign Het
Slc26a2 A T 18: 61,332,558 (GRCm39) I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 (GRCm38) D600E probably damaging Het
Slc5a6 A T 5: 31,195,427 (GRCm39) F430L possibly damaging Het
Snx19 A C 9: 30,351,453 (GRCm39) Q840H probably damaging Het
Spast C A 17: 74,676,211 (GRCm39) D340E probably damaging Het
Sprr4 G A 3: 92,407,716 (GRCm39) P29S unknown Het
Stk11ip T G 1: 75,503,799 (GRCm39) L239R probably damaging Het
Thoc6 A G 17: 23,889,862 (GRCm39) L20P probably damaging Het
Tnfrsf8 A T 4: 145,023,447 (GRCm39) S129T probably benign Het
Tnrc6c A G 11: 117,633,753 (GRCm39) I1284V probably benign Het
Ttn T C 2: 76,602,851 (GRCm39) Y16711C probably damaging Het
Ttn A G 2: 76,541,331 (GRCm39) L33885P probably damaging Het
Ubn2 T A 6: 38,456,075 (GRCm39) C501S probably damaging Het
Ubr1 A T 2: 120,793,923 (GRCm39) L87* probably null Het
Uhmk1 T C 1: 170,027,470 (GRCm39) Y320C probably damaging Het
Vldlr T C 19: 27,217,947 (GRCm39) V465A probably damaging Het
Vmn1r1 C T 1: 181,985,471 (GRCm39) A65T probably benign Het
Vmn2r25 C T 6: 123,800,182 (GRCm39) C720Y probably damaging Het
Xrra1 T C 7: 99,555,775 (GRCm39) Y381H probably benign Het
Zfhx4 T C 3: 5,465,212 (GRCm39) L1790P probably benign Het
Zscan4d T A 7: 10,896,594 (GRCm39) M259L probably benign Het
Other mutations in Cpsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cpsf2 APN 12 101,949,725 (GRCm39) missense probably damaging 1.00
IGL01114:Cpsf2 APN 12 101,956,098 (GRCm39) missense possibly damaging 0.93
IGL01121:Cpsf2 APN 12 101,954,965 (GRCm39) missense probably damaging 1.00
IGL01377:Cpsf2 APN 12 101,953,640 (GRCm39) splice site probably null
IGL01465:Cpsf2 APN 12 101,963,592 (GRCm39) missense probably damaging 1.00
IGL02861:Cpsf2 APN 12 101,965,825 (GRCm39) missense probably benign 0.00
R0469:Cpsf2 UTSW 12 101,955,045 (GRCm39) missense probably damaging 1.00
R0504:Cpsf2 UTSW 12 101,956,262 (GRCm39) missense probably damaging 1.00
R0510:Cpsf2 UTSW 12 101,955,045 (GRCm39) missense probably damaging 1.00
R0626:Cpsf2 UTSW 12 101,951,490 (GRCm39) missense probably benign 0.09
R0697:Cpsf2 UTSW 12 101,949,443 (GRCm39) missense probably benign 0.34
R0837:Cpsf2 UTSW 12 101,963,501 (GRCm39) splice site probably benign
R1475:Cpsf2 UTSW 12 101,951,495 (GRCm39) missense probably damaging 1.00
R1709:Cpsf2 UTSW 12 101,965,801 (GRCm39) missense probably damaging 1.00
R1974:Cpsf2 UTSW 12 101,956,306 (GRCm39) missense probably benign 0.33
R1996:Cpsf2 UTSW 12 101,964,867 (GRCm39) missense probably benign 0.18
R2063:Cpsf2 UTSW 12 101,949,722 (GRCm39) missense probably damaging 1.00
R2164:Cpsf2 UTSW 12 101,951,594 (GRCm39) missense probably damaging 1.00
R2228:Cpsf2 UTSW 12 101,956,088 (GRCm39) missense probably benign 0.00
R3082:Cpsf2 UTSW 12 101,955,069 (GRCm39) missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101,953,567 (GRCm39) missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101,953,567 (GRCm39) missense probably damaging 0.99
R3733:Cpsf2 UTSW 12 101,953,567 (GRCm39) missense probably damaging 0.99
R4627:Cpsf2 UTSW 12 101,956,154 (GRCm39) missense probably benign 0.18
R4665:Cpsf2 UTSW 12 101,949,466 (GRCm39) missense probably damaging 1.00
R4666:Cpsf2 UTSW 12 101,949,466 (GRCm39) missense probably damaging 1.00
R4777:Cpsf2 UTSW 12 101,963,091 (GRCm39) missense probably damaging 0.99
R4847:Cpsf2 UTSW 12 101,963,561 (GRCm39) missense probably benign 0.18
R4923:Cpsf2 UTSW 12 101,948,243 (GRCm39) missense probably benign
R4975:Cpsf2 UTSW 12 101,949,752 (GRCm39) missense probably damaging 1.00
R5239:Cpsf2 UTSW 12 101,953,532 (GRCm39) nonsense probably null
R5440:Cpsf2 UTSW 12 101,963,138 (GRCm39) missense probably benign
R5601:Cpsf2 UTSW 12 101,951,614 (GRCm39) splice site probably null
R5603:Cpsf2 UTSW 12 101,964,890 (GRCm39) missense probably benign 0.02
R5841:Cpsf2 UTSW 12 101,951,497 (GRCm39) missense probably damaging 0.99
R6153:Cpsf2 UTSW 12 101,965,619 (GRCm39) splice site probably null
R6663:Cpsf2 UTSW 12 101,965,852 (GRCm39) missense probably damaging 1.00
R7451:Cpsf2 UTSW 12 101,967,051 (GRCm39) missense possibly damaging 0.52
R8357:Cpsf2 UTSW 12 101,968,929 (GRCm39) missense probably damaging 0.99
R8457:Cpsf2 UTSW 12 101,968,929 (GRCm39) missense probably damaging 0.99
R9123:Cpsf2 UTSW 12 101,963,555 (GRCm39) missense probably damaging 0.96
R9433:Cpsf2 UTSW 12 101,948,252 (GRCm39) missense probably damaging 1.00
V8831:Cpsf2 UTSW 12 101,969,400 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGGGACATGATGACCTG -3'
(R):5'- CTTTACTACGAATGCTCAGAGTGG -3'

Sequencing Primer
(F):5'- GGACATGATGACCTGTTGCCAAAC -3'
(R):5'- AGAGTGGCCCTCAGCATTTC -3'
Posted On 2015-12-21