Mutagenetix > Incidental Mutation

Incidental Mutation 'R4765:Mkl2'

366093

Institutional Source

Beutler Lab

Gene Symbol

Mkl2

Ensembl Gene

ENSMUSG00000009569

Gene Name

MKL/myocardin-like 2

Synonyms

Gt4-1, MRTF-B, Mrtfb

MMRRC Submission

042406-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13256481-13417529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 13412594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 1048 (P1048T)

Ref Sequence

ENSEMBL: ENSMUSP00000122815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000009713
AA Change: P1059T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: P1059T

Domain	Start	End	E-Value	Type
RPEL	51	76	9.67e-5	SMART
RPEL	95	120	2.22e-4	SMART
RPEL	139	164	1.56e-8	SMART
low complexity region	217	230	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	329	352	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
SAP	394	428	1.29e-8	SMART
low complexity region	495	510	N/A	INTRINSIC
coiled coil region	552	601	N/A	INTRINSIC
low complexity region	603	617	N/A	INTRINSIC
low complexity region	699	722	N/A	INTRINSIC
low complexity region	749	775	N/A	INTRINSIC
low complexity region	842	854	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1057	1074	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140892

Predicted Effect

probably damaging
Transcript: ENSMUST00000149359
AA Change: P1048T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: P1048T

Domain	Start	End	E-Value	Type
RPEL	40	65	4.51e-5	SMART
RPEL	84	109	2.22e-4	SMART
RPEL	128	153	1.56e-8	SMART
low complexity region	206	219	N/A	INTRINSIC
low complexity region	280	293	N/A	INTRINSIC
low complexity region	318	341	N/A	INTRINSIC
low complexity region	358	370	N/A	INTRINSIC
SAP	383	417	1.29e-8	SMART
low complexity region	484	499	N/A	INTRINSIC
coiled coil region	541	590	N/A	INTRINSIC
low complexity region	592	606	N/A	INTRINSIC
low complexity region	688	711	N/A	INTRINSIC
low complexity region	738	764	N/A	INTRINSIC
low complexity region	831	843	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1046	1063	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210378

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Bicc1	T	C	10: 70,940,593	T759A	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Rad9a	C	A	19: 4,200,489	V109L	probably benign	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Scyl2	C	T	10: 89,659,298	V304I	probably damaging	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Snx19	A	C	9: 30,440,157	Q840H	probably damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,877	S129T	probably benign	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Ubr1	A	T	2: 120,963,442	L87*	probably null	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zfhx4	T	C	3: 5,400,152	L1790P	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Mkl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Mkl2	APN	16	13403222	missense	probably benign	0.28
IGL00546:Mkl2	APN	16	13403225	missense	possibly damaging	0.71
IGL01325:Mkl2	APN	16	13401224	missense	probably damaging	1.00
IGL02125:Mkl2	APN	16	13400183	splice site	probably null
IGL02803:Mkl2	APN	16	13403156	missense	possibly damaging	0.94
IGL03143:Mkl2	APN	16	13400812	missense	possibly damaging	0.46
IGL03180:Mkl2	APN	16	13398332	missense	probably damaging	1.00
R0281:Mkl2	UTSW	16	13412163	missense	probably damaging	0.99
R0505:Mkl2	UTSW	16	13412526	missense	possibly damaging	0.80
R0540:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R0607:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R1073:Mkl2	UTSW	16	13412318	missense	possibly damaging	0.89
R1423:Mkl2	UTSW	16	13412241	missense	possibly damaging	0.96
R1432:Mkl2	UTSW	16	13401002	missense	probably benign	0.01
R1459:Mkl2	UTSW	16	13401569	missense	possibly damaging	0.93
R1693:Mkl2	UTSW	16	13398470	missense	possibly damaging	0.67
R1693:Mkl2	UTSW	16	13398471	missense	probably damaging	0.99
R2006:Mkl2	UTSW	16	13381576	nonsense	probably null
R2076:Mkl2	UTSW	16	13401382	missense	probably benign	0.01
R2125:Mkl2	UTSW	16	13400804	missense	possibly damaging	0.94
R2145:Mkl2	UTSW	16	13412586	missense	probably damaging	0.98
R3722:Mkl2	UTSW	16	13385693	missense	probably damaging	1.00
R3883:Mkl2	UTSW	16	13401458	missense	probably damaging	0.99
R4088:Mkl2	UTSW	16	13384200	missense	probably damaging	0.98
R4204:Mkl2	UTSW	16	13403255	missense	possibly damaging	0.88
R4301:Mkl2	UTSW	16	13398305	missense	probably damaging	1.00
R4622:Mkl2	UTSW	16	13332706	missense	probably damaging	1.00
R4633:Mkl2	UTSW	16	13379873	missense	possibly damaging	0.95
R5201:Mkl2	UTSW	16	13401592	missense	probably benign	0.00
R5403:Mkl2	UTSW	16	13401013	missense	probably damaging	0.97
R5725:Mkl2	UTSW	16	13384310	nonsense	probably null
R6511:Mkl2	UTSW	16	13379850	missense	probably damaging	1.00
R7207:Mkl2	UTSW	16	13326436	missense	probably benign
R7269:Mkl2	UTSW	16	13401034	missense	possibly damaging	0.48
R7311:Mkl2	UTSW	16	13405854	nonsense	probably null
R7460:Mkl2	UTSW	16	13400976	missense	probably benign	0.00
R8480:Mkl2	UTSW	16	13384192	critical splice acceptor site	probably null
R9032:Mkl2	UTSW	16	13412228	missense	probably damaging	1.00
R9085:Mkl2	UTSW	16	13412228	missense	probably damaging	1.00
R9098:Mkl2	UTSW	16	13403189	missense	probably benign
R9229:Mkl2	UTSW	16	13412321	missense	possibly damaging	0.89
R9298:Mkl2	UTSW	16	13384218	missense	probably benign	0.10
R9310:Mkl2	UTSW	16	13401090	missense	probably benign
R9343:Mkl2	UTSW	16	13400927	missense	probably benign	0.00
R9436:Mkl2	UTSW	16	13405287	nonsense	probably null
Z1177:Mkl2	UTSW	16	13385606	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCTAGAAGCCTTCTTGGATG -3'
(R):5'- ACACTGGCCTCTCAGGTTTG -3'

Sequencing Primer
(F):5'- CAGCAGTGAAGATAGAGAGTCTTTC -3'
(R):5'- GTTTCCATGTTTCCAAATCTCACGAG -3'

Posted On

2015-12-21