Incidental Mutation 'R4765:Mkl2'
ID366093
Institutional Source Beutler Lab
Gene Symbol Mkl2
Ensembl Gene ENSMUSG00000009569
Gene NameMKL/myocardin-like 2
SynonymsGt4-1, MRTF-B, Mrtfb
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location13256481-13417529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 13412594 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 1048 (P1048T)
Ref Sequence ENSEMBL: ENSMUSP00000122815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]
Predicted Effect probably damaging
Transcript: ENSMUST00000009713
AA Change: P1059T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: P1059T

DomainStartEndE-ValueType
RPEL 51 76 9.67e-5 SMART
RPEL 95 120 2.22e-4 SMART
RPEL 139 164 1.56e-8 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 329 352 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
SAP 394 428 1.29e-8 SMART
low complexity region 495 510 N/A INTRINSIC
coiled coil region 552 601 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
low complexity region 699 722 N/A INTRINSIC
low complexity region 749 775 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1057 1074 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140892
Predicted Effect probably damaging
Transcript: ENSMUST00000149359
AA Change: P1048T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: P1048T

DomainStartEndE-ValueType
RPEL 40 65 4.51e-5 SMART
RPEL 84 109 2.22e-4 SMART
RPEL 128 153 1.56e-8 SMART
low complexity region 206 219 N/A INTRINSIC
low complexity region 280 293 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
SAP 383 417 1.29e-8 SMART
low complexity region 484 499 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 688 711 N/A INTRINSIC
low complexity region 738 764 N/A INTRINSIC
low complexity region 831 843 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210378
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Mkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Mkl2 APN 16 13403222 missense probably benign 0.28
IGL00546:Mkl2 APN 16 13403225 missense possibly damaging 0.71
IGL01325:Mkl2 APN 16 13401224 missense probably damaging 1.00
IGL02125:Mkl2 APN 16 13400183 splice site probably null
IGL02803:Mkl2 APN 16 13403156 missense possibly damaging 0.94
IGL03143:Mkl2 APN 16 13400812 missense possibly damaging 0.46
IGL03180:Mkl2 APN 16 13398332 missense probably damaging 1.00
R0281:Mkl2 UTSW 16 13412163 missense probably damaging 0.99
R0505:Mkl2 UTSW 16 13412526 missense possibly damaging 0.80
R0540:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R0607:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R1073:Mkl2 UTSW 16 13412318 missense possibly damaging 0.89
R1423:Mkl2 UTSW 16 13412241 missense possibly damaging 0.96
R1432:Mkl2 UTSW 16 13401002 missense probably benign 0.01
R1459:Mkl2 UTSW 16 13401569 missense possibly damaging 0.93
R1693:Mkl2 UTSW 16 13398470 missense possibly damaging 0.67
R1693:Mkl2 UTSW 16 13398471 missense probably damaging 0.99
R2006:Mkl2 UTSW 16 13381576 nonsense probably null
R2076:Mkl2 UTSW 16 13401382 missense probably benign 0.01
R2125:Mkl2 UTSW 16 13400804 missense possibly damaging 0.94
R2145:Mkl2 UTSW 16 13412586 missense probably damaging 0.98
R3722:Mkl2 UTSW 16 13385693 missense probably damaging 1.00
R3883:Mkl2 UTSW 16 13401458 missense probably damaging 0.99
R4088:Mkl2 UTSW 16 13384200 missense probably damaging 0.98
R4204:Mkl2 UTSW 16 13403255 missense possibly damaging 0.88
R4301:Mkl2 UTSW 16 13398305 missense probably damaging 1.00
R4622:Mkl2 UTSW 16 13332706 missense probably damaging 1.00
R4633:Mkl2 UTSW 16 13379873 missense possibly damaging 0.95
R5201:Mkl2 UTSW 16 13401592 missense probably benign 0.00
R5403:Mkl2 UTSW 16 13401013 missense probably damaging 0.97
R5725:Mkl2 UTSW 16 13384310 nonsense probably null
R6511:Mkl2 UTSW 16 13379850 missense probably damaging 1.00
R7207:Mkl2 UTSW 16 13326436 missense probably benign
R7269:Mkl2 UTSW 16 13401034 missense possibly damaging 0.48
R7311:Mkl2 UTSW 16 13405854 nonsense probably null
R7460:Mkl2 UTSW 16 13400976 missense probably benign 0.00
Z1177:Mkl2 UTSW 16 13385606 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTAGAAGCCTTCTTGGATG -3'
(R):5'- ACACTGGCCTCTCAGGTTTG -3'

Sequencing Primer
(F):5'- CAGCAGTGAAGATAGAGAGTCTTTC -3'
(R):5'- GTTTCCATGTTTCCAAATCTCACGAG -3'
Posted On2015-12-21