Incidental Mutation 'R4765:Mrtfb'
ID 366093
Institutional Source Beutler Lab
Gene Symbol Mrtfb
Ensembl Gene ENSMUSG00000009569
Gene Name myocardin related transcription factor B
Synonyms Mkl2, Gt4-1, Mrtfb, MRTF-B
MMRRC Submission 042406-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4765 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 13074345-13235393 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 13230458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 1048 (P1048T)
Ref Sequence ENSEMBL: ENSMUSP00000122815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000009713
AA Change: P1059T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: P1059T

DomainStartEndE-ValueType
RPEL 51 76 9.67e-5 SMART
RPEL 95 120 2.22e-4 SMART
RPEL 139 164 1.56e-8 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 329 352 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
SAP 394 428 1.29e-8 SMART
low complexity region 495 510 N/A INTRINSIC
coiled coil region 552 601 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
low complexity region 699 722 N/A INTRINSIC
low complexity region 749 775 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1057 1074 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140892
Predicted Effect probably damaging
Transcript: ENSMUST00000149359
AA Change: P1048T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: P1048T

DomainStartEndE-ValueType
RPEL 40 65 4.51e-5 SMART
RPEL 84 109 2.22e-4 SMART
RPEL 128 153 1.56e-8 SMART
low complexity region 206 219 N/A INTRINSIC
low complexity region 280 293 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
SAP 383 417 1.29e-8 SMART
low complexity region 484 499 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 688 711 N/A INTRINSIC
low complexity region 738 764 N/A INTRINSIC
low complexity region 831 843 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210378
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,771,987 (GRCm39) R490C probably benign Het
Abcb11 A T 2: 69,076,211 (GRCm39) F1166I probably damaging Het
Acta2 T C 19: 34,223,552 (GRCm39) D181G probably damaging Het
Adgrv1 A G 13: 81,255,038 (GRCm39) I6195T probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ankfy1 T G 11: 72,603,117 (GRCm39) S49A probably benign Het
Azi2 A T 9: 117,890,539 (GRCm39) probably benign Het
Bend3 A T 10: 43,386,746 (GRCm39) S380C probably damaging Het
Bicc1 T C 10: 70,776,423 (GRCm39) T759A probably damaging Het
Cdh10 G T 15: 19,013,364 (GRCm39) V655L probably damaging Het
Cdkn2aip C A 8: 48,166,582 (GRCm39) W75L probably damaging Het
Cenpj G A 14: 56,787,002 (GRCm39) R192* probably null Het
Cflar T C 1: 58,771,480 (GRCm39) S203P probably damaging Het
Chd6 A T 2: 160,808,164 (GRCm39) C1683* probably null Het
Cpsf2 A G 12: 101,963,699 (GRCm39) Y476C probably damaging Het
Cyp4a12a A G 4: 115,183,388 (GRCm39) D169G possibly damaging Het
D430041D05Rik T A 2: 104,044,441 (GRCm39) R1536S probably damaging Het
Depdc5 A C 5: 33,094,979 (GRCm39) D752A probably damaging Het
Dnah9 C T 11: 65,818,552 (GRCm39) G78D probably damaging Het
Drc1 G T 5: 30,506,075 (GRCm39) Q249H probably benign Het
Drg1 T C 11: 3,200,280 (GRCm39) I364V probably benign Het
Dtymk T C 1: 93,720,631 (GRCm39) H130R probably damaging Het
Elac2 T G 11: 64,883,048 (GRCm39) F140V probably damaging Het
Enpp2 A G 15: 54,739,068 (GRCm39) V353A possibly damaging Het
Fat2 T C 11: 55,172,013 (GRCm39) D2900G probably damaging Het
Fermt2 G T 14: 45,699,693 (GRCm39) T536K probably benign Het
Foxj2 G T 6: 122,810,230 (GRCm39) Q196H probably benign Het
Gadl1 A G 9: 115,795,381 (GRCm39) K328R probably null Het
Gata6 A G 18: 11,054,394 (GRCm39) T108A probably benign Het
Gm16503 G T 4: 147,625,554 (GRCm39) G16V unknown Het
Gpr37 T G 6: 25,669,107 (GRCm39) E579A probably damaging Het
Gps2 T C 11: 69,807,187 (GRCm39) probably benign Het
Hcn4 A T 9: 58,765,260 (GRCm39) I581F unknown Het
Hfm1 T A 5: 106,990,405 (GRCm39) Y1335F probably benign Het
Igsf10 A T 3: 59,237,126 (GRCm39) S1018R probably benign Het
Katnal2 C T 18: 77,065,239 (GRCm39) probably null Het
Kctd8 T C 5: 69,498,191 (GRCm39) K152E possibly damaging Het
Lrp8 T C 4: 107,711,592 (GRCm39) C459R probably damaging Het
Ly6l A T 15: 75,321,543 (GRCm39) I48L probably benign Het
Megf10 A T 18: 57,420,866 (GRCm39) I835F possibly damaging Het
Mei1 A T 15: 81,996,686 (GRCm39) I946F possibly damaging Het
Myo7b G C 18: 32,094,953 (GRCm39) L1881V probably benign Het
Nfkbiz T C 16: 55,639,387 (GRCm39) probably null Het
Or4b13 T A 2: 90,082,807 (GRCm39) Y175F probably damaging Het
Or5b24 T C 19: 12,912,440 (GRCm39) C113R possibly damaging Het
Pcdhgc5 T C 18: 37,955,122 (GRCm39) S799P probably benign Het
Plk4 A G 3: 40,756,457 (GRCm39) E97G probably damaging Het
Pole2 A T 12: 69,268,826 (GRCm39) H114Q possibly damaging Het
Rad9a C A 19: 4,250,488 (GRCm39) V109L probably benign Het
Scn8a A G 15: 100,938,352 (GRCm39) H1917R probably benign Het
Scyl2 C T 10: 89,495,160 (GRCm39) V304I probably damaging Het
Serpina3f G C 12: 104,185,690 (GRCm39) E298D probably benign Het
Shoc2 A G 19: 53,976,734 (GRCm39) E208G probably benign Het
Sin3a G A 9: 57,004,087 (GRCm39) V280I probably benign Het
Slc26a2 A T 18: 61,332,558 (GRCm39) I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 (GRCm38) D600E probably damaging Het
Slc5a6 A T 5: 31,195,427 (GRCm39) F430L possibly damaging Het
Snx19 A C 9: 30,351,453 (GRCm39) Q840H probably damaging Het
Spast C A 17: 74,676,211 (GRCm39) D340E probably damaging Het
Sprr4 G A 3: 92,407,716 (GRCm39) P29S unknown Het
Stk11ip T G 1: 75,503,799 (GRCm39) L239R probably damaging Het
Thoc6 A G 17: 23,889,862 (GRCm39) L20P probably damaging Het
Tnfrsf8 A T 4: 145,023,447 (GRCm39) S129T probably benign Het
Tnrc6c A G 11: 117,633,753 (GRCm39) I1284V probably benign Het
Ttn T C 2: 76,602,851 (GRCm39) Y16711C probably damaging Het
Ttn A G 2: 76,541,331 (GRCm39) L33885P probably damaging Het
Ubn2 T A 6: 38,456,075 (GRCm39) C501S probably damaging Het
Ubr1 A T 2: 120,793,923 (GRCm39) L87* probably null Het
Uhmk1 T C 1: 170,027,470 (GRCm39) Y320C probably damaging Het
Vldlr T C 19: 27,217,947 (GRCm39) V465A probably damaging Het
Vmn1r1 C T 1: 181,985,471 (GRCm39) A65T probably benign Het
Vmn2r25 C T 6: 123,800,182 (GRCm39) C720Y probably damaging Het
Xrra1 T C 7: 99,555,775 (GRCm39) Y381H probably benign Het
Zfhx4 T C 3: 5,465,212 (GRCm39) L1790P probably benign Het
Zscan4d T A 7: 10,896,594 (GRCm39) M259L probably benign Het
Other mutations in Mrtfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Mrtfb APN 16 13,221,089 (GRCm39) missense possibly damaging 0.71
IGL00546:Mrtfb APN 16 13,221,086 (GRCm39) missense probably benign 0.28
IGL01325:Mrtfb APN 16 13,219,088 (GRCm39) missense probably damaging 1.00
IGL02125:Mrtfb APN 16 13,218,047 (GRCm39) splice site probably null
IGL02803:Mrtfb APN 16 13,221,020 (GRCm39) missense possibly damaging 0.94
IGL03143:Mrtfb APN 16 13,218,676 (GRCm39) missense possibly damaging 0.46
IGL03180:Mrtfb APN 16 13,216,196 (GRCm39) missense probably damaging 1.00
R0281:Mrtfb UTSW 16 13,230,027 (GRCm39) missense probably damaging 0.99
R0505:Mrtfb UTSW 16 13,230,390 (GRCm39) missense possibly damaging 0.80
R0540:Mrtfb UTSW 16 13,199,465 (GRCm39) missense probably damaging 1.00
R0607:Mrtfb UTSW 16 13,199,465 (GRCm39) missense probably damaging 1.00
R1073:Mrtfb UTSW 16 13,230,182 (GRCm39) missense possibly damaging 0.89
R1423:Mrtfb UTSW 16 13,230,105 (GRCm39) missense possibly damaging 0.96
R1432:Mrtfb UTSW 16 13,218,866 (GRCm39) missense probably benign 0.01
R1459:Mrtfb UTSW 16 13,219,433 (GRCm39) missense possibly damaging 0.93
R1693:Mrtfb UTSW 16 13,216,335 (GRCm39) missense probably damaging 0.99
R1693:Mrtfb UTSW 16 13,216,334 (GRCm39) missense possibly damaging 0.67
R2006:Mrtfb UTSW 16 13,199,440 (GRCm39) nonsense probably null
R2076:Mrtfb UTSW 16 13,219,246 (GRCm39) missense probably benign 0.01
R2125:Mrtfb UTSW 16 13,218,668 (GRCm39) missense possibly damaging 0.94
R2145:Mrtfb UTSW 16 13,230,450 (GRCm39) missense probably damaging 0.98
R3722:Mrtfb UTSW 16 13,203,557 (GRCm39) missense probably damaging 1.00
R3883:Mrtfb UTSW 16 13,219,322 (GRCm39) missense probably damaging 0.99
R4088:Mrtfb UTSW 16 13,202,064 (GRCm39) missense probably damaging 0.98
R4204:Mrtfb UTSW 16 13,221,119 (GRCm39) missense possibly damaging 0.88
R4301:Mrtfb UTSW 16 13,216,169 (GRCm39) missense probably damaging 1.00
R4622:Mrtfb UTSW 16 13,150,570 (GRCm39) missense probably damaging 1.00
R4633:Mrtfb UTSW 16 13,197,737 (GRCm39) missense possibly damaging 0.95
R5201:Mrtfb UTSW 16 13,219,456 (GRCm39) missense probably benign 0.00
R5403:Mrtfb UTSW 16 13,218,877 (GRCm39) missense probably damaging 0.97
R5725:Mrtfb UTSW 16 13,202,174 (GRCm39) nonsense probably null
R6511:Mrtfb UTSW 16 13,197,714 (GRCm39) missense probably damaging 1.00
R7207:Mrtfb UTSW 16 13,144,300 (GRCm39) missense probably benign
R7269:Mrtfb UTSW 16 13,218,898 (GRCm39) missense possibly damaging 0.48
R7311:Mrtfb UTSW 16 13,223,718 (GRCm39) nonsense probably null
R7460:Mrtfb UTSW 16 13,218,840 (GRCm39) missense probably benign 0.00
R8480:Mrtfb UTSW 16 13,202,056 (GRCm39) critical splice acceptor site probably null
R9032:Mrtfb UTSW 16 13,230,092 (GRCm39) missense probably damaging 1.00
R9085:Mrtfb UTSW 16 13,230,092 (GRCm39) missense probably damaging 1.00
R9098:Mrtfb UTSW 16 13,221,053 (GRCm39) missense probably benign
R9229:Mrtfb UTSW 16 13,230,185 (GRCm39) missense possibly damaging 0.89
R9298:Mrtfb UTSW 16 13,202,082 (GRCm39) missense probably benign 0.10
R9310:Mrtfb UTSW 16 13,218,954 (GRCm39) missense probably benign
R9343:Mrtfb UTSW 16 13,218,791 (GRCm39) missense probably benign 0.00
R9436:Mrtfb UTSW 16 13,223,151 (GRCm39) nonsense probably null
Z1177:Mrtfb UTSW 16 13,203,470 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTAGAAGCCTTCTTGGATG -3'
(R):5'- ACACTGGCCTCTCAGGTTTG -3'

Sequencing Primer
(F):5'- CAGCAGTGAAGATAGAGAGTCTTTC -3'
(R):5'- GTTTCCATGTTTCCAAATCTCACGAG -3'
Posted On 2015-12-21