Incidental Mutation 'R4765:Thoc6'
ID366096
Institutional Source Beutler Lab
Gene Symbol Thoc6
Ensembl Gene ENSMUSG00000041319
Gene NameTHO complex 6
SynonymsWdr58, F830014G06Rik
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23668614-23673882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23670888 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 20 (L20P)
Ref Sequence ENSEMBL: ENSMUSP00000123075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024697] [ENSMUST00000024698] [ENSMUST00000047436] [ENSMUST00000062967] [ENSMUST00000095579] [ENSMUST00000115489] [ENSMUST00000115490] [ENSMUST00000138190] [ENSMUST00000167059] [ENSMUST00000179928] [ENSMUST00000180140]
Predicted Effect probably benign
Transcript: ENSMUST00000024697
SMART Domains Protein: ENSMUSP00000024697
Gene: ENSMUSG00000023904

DomainStartEndE-ValueType
Pfam:HPIP 2 116 7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024698
SMART Domains Protein: ENSMUSP00000024698
Gene: ENSMUSG00000023905

DomainStartEndE-ValueType
Pfam:stn_TNFRSF12A 1 129 4.7e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047436
AA Change: L20P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038137
Gene: ENSMUSG00000041319
AA Change: L20P

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062967
SMART Domains Protein: ENSMUSP00000053808
Gene: ENSMUSG00000043782

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
coiled coil region 63 293 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
coiled coil region 354 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095579
AA Change: L20P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093239
Gene: ENSMUSG00000041319
AA Change: L20P

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115489
AA Change: L16P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111152
Gene: ENSMUSG00000041319
AA Change: L16P

DomainStartEndE-ValueType
Blast:WD40 11 47 6e-18 BLAST
WD40 61 97 2.67e-1 SMART
Blast:WD40 115 150 8e-12 BLAST
WD40 153 192 1.28e-6 SMART
Blast:WD40 196 241 3e-25 BLAST
WD40 244 280 7.36e1 SMART
low complexity region 290 301 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115490
AA Change: L20P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111153
Gene: ENSMUSG00000041319
AA Change: L20P

DomainStartEndE-ValueType
Blast:WD40 13 51 7e-19 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 6e-12 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 8e-26 BLAST
Blast:WD40 248 279 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133849
Predicted Effect probably benign
Transcript: ENSMUST00000135259
SMART Domains Protein: ENSMUSP00000119920
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 32 67 9e-13 BLAST
WD40 70 109 1.28e-6 SMART
Blast:WD40 113 186 4e-20 BLAST
Blast:WD40 189 209 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000138190
AA Change: L20P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123075
Gene: ENSMUSG00000041319
AA Change: L20P

DomainStartEndE-ValueType
Blast:WD40 13 51 6e-20 BLAST
WD40 65 101 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167059
SMART Domains Protein: ENSMUSP00000131574
Gene: ENSMUSG00000023905

DomainStartEndE-ValueType
Pfam:stn_TNFRSF12A 1 35 2.9e-13 PFAM
Pfam:stn_TNFRSF12A 32 94 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179928
SMART Domains Protein: ENSMUSP00000137205
Gene: ENSMUSG00000023904

DomainStartEndE-ValueType
Pfam:HPIP 2 112 3.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180140
SMART Domains Protein: ENSMUSP00000137336
Gene: ENSMUSG00000023904

DomainStartEndE-ValueType
Pfam:HPIP 2 116 2.9e-58 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-protein THO complex, which is involved in coordination between transcription and mRNA processing. The THO complex is a component of the TREX (transcription/export) complex, which is involved in transcription and export of mRNAs. A missense mutation in this gene is associated with a neurodevelopmental disorder called Beaulieu-Boycott-Innes syndrome. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Thoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Thoc6 APN 17 23669883 missense possibly damaging 0.68
PIT4382001:Thoc6 UTSW 17 23668867 missense probably benign
R0100:Thoc6 UTSW 17 23669850 missense probably damaging 1.00
R0114:Thoc6 UTSW 17 23670239 missense probably benign 0.01
R0448:Thoc6 UTSW 17 23669576 missense probably damaging 1.00
R1324:Thoc6 UTSW 17 23677463 splice site probably null
R1917:Thoc6 UTSW 17 23669390 unclassified probably benign
R2894:Thoc6 UTSW 17 23669035 missense probably damaging 0.98
R4125:Thoc6 UTSW 17 23669345 unclassified probably benign
R4791:Thoc6 UTSW 17 23670067 missense possibly damaging 0.74
R4962:Thoc6 UTSW 17 23669937 missense probably damaging 1.00
R5527:Thoc6 UTSW 17 23670795 missense probably damaging 1.00
R5940:Thoc6 UTSW 17 23670341 missense probably benign 0.00
R5965:Thoc6 UTSW 17 23670868 missense possibly damaging 0.80
R6232:Thoc6 UTSW 17 23670321 critical splice donor site probably null
R6639:Thoc6 UTSW 17 23670454 splice site probably null
R7080:Thoc6 UTSW 17 23673529 missense probably null
R7133:Thoc6 UTSW 17 23673660 splice site probably null
R7473:Thoc6 UTSW 17 23670867 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TATACCCACCGTGGAAGACC -3'
(R):5'- CCTGGAGTCACTTTGTATGGGC -3'

Sequencing Primer
(F):5'- TGGCCTCTGAACTTAAGGCAG -3'
(R):5'- CACTTTGTATGGGCTGATGC -3'
Posted On2015-12-21