Incidental Mutation 'R4765:Spast'
ID366098
Institutional Source Beutler Lab
Gene Symbol Spast
Ensembl Gene ENSMUSG00000024068
Gene Namespastin
SynonymsSpg4
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location74338987-74391115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74369216 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 340 (D340E)
Ref Sequence ENSEMBL: ENSMUSP00000153469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024869] [ENSMUST00000224711] [ENSMUST00000225549]
Predicted Effect probably damaging
Transcript: ENSMUST00000024869
AA Change: D341E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024869
Gene: ENSMUSG00000024068
AA Change: D341E

DomainStartEndE-ValueType
low complexity region 3 46 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 90 113 N/A INTRINSIC
MIT 114 192 4.33e-18 SMART
AAA 372 508 7.59e-17 SMART
low complexity region 513 520 N/A INTRINSIC
Pfam:Vps4_C 560 610 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224711
AA Change: D340E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000225549
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The encoded ATPase may be involved in the assembly or function of nuclear protein complexes. Two transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequences have not been determined. Mutations associated with this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene are sterile and display progressive axonopathy with focal axonal swellings and late onset gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Spast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Spast APN 17 74372339 splice site probably benign
R0671:Spast UTSW 17 74339451 splice site probably benign
R1170:Spast UTSW 17 74381968 critical splice acceptor site probably null
R1698:Spast UTSW 17 74356160 nonsense probably null
R2076:Spast UTSW 17 74352031 missense probably damaging 1.00
R4334:Spast UTSW 17 74352015 missense probably damaging 1.00
R5002:Spast UTSW 17 74369226 nonsense probably null
R5911:Spast UTSW 17 74387063 missense probably benign 0.00
R6073:Spast UTSW 17 74373305 missense probably damaging 1.00
R6183:Spast UTSW 17 74373358 missense probably damaging 0.99
R6450:Spast UTSW 17 74368840 missense probably benign 0.01
R6819:Spast UTSW 17 74367286 missense possibly damaging 0.47
R6821:Spast UTSW 17 74351962 missense probably benign 0.02
R7349:Spast UTSW 17 74373324 missense probably damaging 0.99
R7611:Spast UTSW 17 74369203 missense probably damaging 1.00
R7715:Spast UTSW 17 74368926 missense probably benign 0.01
R8348:Spast UTSW 17 74359298 missense probably benign 0.41
R8448:Spast UTSW 17 74359298 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GCCAAGTGCTTCAACTTCTG -3'
(R):5'- ATGCTTGGTCCATCTCCAGG -3'

Sequencing Primer
(F):5'- GATTGTTAAGCTAATACGCC -3'
(R):5'- GGTCCATCTCCAGGCTTCAATG -3'
Posted On2015-12-21