Incidental Mutation 'R4765:Myo7b'
ID 366100
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 042406-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4765 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 32094953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 1881 (L1881V)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025254] [ENSMUST00000134663] [ENSMUST00000223753] [ENSMUST00000224328]
AlphaFold Q99MZ6
Predicted Effect probably benign
Transcript: ENSMUST00000025254
SMART Domains Protein: ENSMUSP00000025254
Gene: ENSMUSG00000024395

DomainStartEndE-ValueType
LIM 14 67 1.15e-14 SMART
LIM 75 126 2.74e-12 SMART
LIM 139 189 3.87e-12 SMART
LIM 197 248 4.31e-19 SMART
LIM 256 308 2.67e-15 SMART
low complexity region 314 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: L1881V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: L1881V

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223753
Predicted Effect probably benign
Transcript: ENSMUST00000224328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225125
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,771,987 (GRCm39) R490C probably benign Het
Abcb11 A T 2: 69,076,211 (GRCm39) F1166I probably damaging Het
Acta2 T C 19: 34,223,552 (GRCm39) D181G probably damaging Het
Adgrv1 A G 13: 81,255,038 (GRCm39) I6195T probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ankfy1 T G 11: 72,603,117 (GRCm39) S49A probably benign Het
Azi2 A T 9: 117,890,539 (GRCm39) probably benign Het
Bend3 A T 10: 43,386,746 (GRCm39) S380C probably damaging Het
Bicc1 T C 10: 70,776,423 (GRCm39) T759A probably damaging Het
Cdh10 G T 15: 19,013,364 (GRCm39) V655L probably damaging Het
Cdkn2aip C A 8: 48,166,582 (GRCm39) W75L probably damaging Het
Cenpj G A 14: 56,787,002 (GRCm39) R192* probably null Het
Cflar T C 1: 58,771,480 (GRCm39) S203P probably damaging Het
Chd6 A T 2: 160,808,164 (GRCm39) C1683* probably null Het
Cpsf2 A G 12: 101,963,699 (GRCm39) Y476C probably damaging Het
Cyp4a12a A G 4: 115,183,388 (GRCm39) D169G possibly damaging Het
D430041D05Rik T A 2: 104,044,441 (GRCm39) R1536S probably damaging Het
Depdc5 A C 5: 33,094,979 (GRCm39) D752A probably damaging Het
Dnah9 C T 11: 65,818,552 (GRCm39) G78D probably damaging Het
Drc1 G T 5: 30,506,075 (GRCm39) Q249H probably benign Het
Drg1 T C 11: 3,200,280 (GRCm39) I364V probably benign Het
Dtymk T C 1: 93,720,631 (GRCm39) H130R probably damaging Het
Elac2 T G 11: 64,883,048 (GRCm39) F140V probably damaging Het
Enpp2 A G 15: 54,739,068 (GRCm39) V353A possibly damaging Het
Fat2 T C 11: 55,172,013 (GRCm39) D2900G probably damaging Het
Fermt2 G T 14: 45,699,693 (GRCm39) T536K probably benign Het
Foxj2 G T 6: 122,810,230 (GRCm39) Q196H probably benign Het
Gadl1 A G 9: 115,795,381 (GRCm39) K328R probably null Het
Gata6 A G 18: 11,054,394 (GRCm39) T108A probably benign Het
Gm16503 G T 4: 147,625,554 (GRCm39) G16V unknown Het
Gpr37 T G 6: 25,669,107 (GRCm39) E579A probably damaging Het
Gps2 T C 11: 69,807,187 (GRCm39) probably benign Het
Hcn4 A T 9: 58,765,260 (GRCm39) I581F unknown Het
Hfm1 T A 5: 106,990,405 (GRCm39) Y1335F probably benign Het
Igsf10 A T 3: 59,237,126 (GRCm39) S1018R probably benign Het
Katnal2 C T 18: 77,065,239 (GRCm39) probably null Het
Kctd8 T C 5: 69,498,191 (GRCm39) K152E possibly damaging Het
Lrp8 T C 4: 107,711,592 (GRCm39) C459R probably damaging Het
Ly6l A T 15: 75,321,543 (GRCm39) I48L probably benign Het
Megf10 A T 18: 57,420,866 (GRCm39) I835F possibly damaging Het
Mei1 A T 15: 81,996,686 (GRCm39) I946F possibly damaging Het
Mrtfb C A 16: 13,230,458 (GRCm39) P1048T probably damaging Het
Nfkbiz T C 16: 55,639,387 (GRCm39) probably null Het
Or4b13 T A 2: 90,082,807 (GRCm39) Y175F probably damaging Het
Or5b24 T C 19: 12,912,440 (GRCm39) C113R possibly damaging Het
Pcdhgc5 T C 18: 37,955,122 (GRCm39) S799P probably benign Het
Plk4 A G 3: 40,756,457 (GRCm39) E97G probably damaging Het
Pole2 A T 12: 69,268,826 (GRCm39) H114Q possibly damaging Het
Rad9a C A 19: 4,250,488 (GRCm39) V109L probably benign Het
Scn8a A G 15: 100,938,352 (GRCm39) H1917R probably benign Het
Scyl2 C T 10: 89,495,160 (GRCm39) V304I probably damaging Het
Serpina3f G C 12: 104,185,690 (GRCm39) E298D probably benign Het
Shoc2 A G 19: 53,976,734 (GRCm39) E208G probably benign Het
Sin3a G A 9: 57,004,087 (GRCm39) V280I probably benign Het
Slc26a2 A T 18: 61,332,558 (GRCm39) I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 (GRCm38) D600E probably damaging Het
Slc5a6 A T 5: 31,195,427 (GRCm39) F430L possibly damaging Het
Snx19 A C 9: 30,351,453 (GRCm39) Q840H probably damaging Het
Spast C A 17: 74,676,211 (GRCm39) D340E probably damaging Het
Sprr4 G A 3: 92,407,716 (GRCm39) P29S unknown Het
Stk11ip T G 1: 75,503,799 (GRCm39) L239R probably damaging Het
Thoc6 A G 17: 23,889,862 (GRCm39) L20P probably damaging Het
Tnfrsf8 A T 4: 145,023,447 (GRCm39) S129T probably benign Het
Tnrc6c A G 11: 117,633,753 (GRCm39) I1284V probably benign Het
Ttn T C 2: 76,602,851 (GRCm39) Y16711C probably damaging Het
Ttn A G 2: 76,541,331 (GRCm39) L33885P probably damaging Het
Ubn2 T A 6: 38,456,075 (GRCm39) C501S probably damaging Het
Ubr1 A T 2: 120,793,923 (GRCm39) L87* probably null Het
Uhmk1 T C 1: 170,027,470 (GRCm39) Y320C probably damaging Het
Vldlr T C 19: 27,217,947 (GRCm39) V465A probably damaging Het
Vmn1r1 C T 1: 181,985,471 (GRCm39) A65T probably benign Het
Vmn2r25 C T 6: 123,800,182 (GRCm39) C720Y probably damaging Het
Xrra1 T C 7: 99,555,775 (GRCm39) Y381H probably benign Het
Zfhx4 T C 3: 5,465,212 (GRCm39) L1790P probably benign Het
Zscan4d T A 7: 10,896,594 (GRCm39) M259L probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACCCTGCTGCAAGAAC -3'
(R):5'- TACGCAGCTTGATGAAAATGAG -3'

Sequencing Primer
(F):5'- AACCTGGGGCAAGACAGTCC -3'
(R):5'- CTTGATGAAAATGAGTTGAGGGCCC -3'
Posted On 2015-12-21