Incidental Mutation 'R4765:Myo7b'
ID366100
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 31961900 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 1881 (L1881V)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025254] [ENSMUST00000134663] [ENSMUST00000223753] [ENSMUST00000224328]
Predicted Effect probably benign
Transcript: ENSMUST00000025254
SMART Domains Protein: ENSMUSP00000025254
Gene: ENSMUSG00000024395

DomainStartEndE-ValueType
LIM 14 67 1.15e-14 SMART
LIM 75 126 2.74e-12 SMART
LIM 139 189 3.87e-12 SMART
LIM 197 248 4.31e-19 SMART
LIM 256 308 2.67e-15 SMART
low complexity region 314 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: L1881V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: L1881V

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223753
Predicted Effect probably benign
Transcript: ENSMUST00000224328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225125
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACCCTGCTGCAAGAAC -3'
(R):5'- TACGCAGCTTGATGAAAATGAG -3'

Sequencing Primer
(F):5'- AACCTGGGGCAAGACAGTCC -3'
(R):5'- CTTGATGAAAATGAGTTGAGGGCCC -3'
Posted On2015-12-21