Incidental Mutation 'R4765:Slc26a2'
ID366103
Institutional Source Beutler Lab
Gene Symbol Slc26a2
Ensembl Gene ENSMUSG00000034320
Gene Namesolute carrier family 26 (sulfate transporter), member 2
SynonymsDtd, ST-OB
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61192919-61211612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61199486 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 291 (I291N)
Ref Sequence ENSEMBL: ENSMUSP00000119447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037603] [ENSMUST00000146409] [ENSMUST00000148829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037603
AA Change: I56N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040163
Gene: ENSMUSG00000034320
AA Change: I56N

DomainStartEndE-ValueType
Pfam:Sulfate_transp 1 279 5.8e-83 PFAM
low complexity region 317 330 N/A INTRINSIC
Pfam:STAS 334 480 5.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146409
AA Change: I291N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119447
Gene: ENSMUSG00000034320
AA Change: I291N

DomainStartEndE-ValueType
Pfam:Sulfate_transp 108 518 1.8e-133 PFAM
low complexity region 552 565 N/A INTRINSIC
Pfam:STAS 569 715 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148829
SMART Domains Protein: ENSMUSP00000114419
Gene: ENSMUSG00000034320

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 93 176 1.1e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The diastrophic dysplasia sulfate transporter is a transmembrane glycoprotein implicated in the pathogenesis of several human chondrodysplasias. It apparently is critical in cartilage for sulfation of proteoglycans and matrix organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit premature death, stunted growth, joint contractures, and skeletal dysplasia including kyphosis, shorter osteoporotic long bones, aberrant chondrocyte size, delayed endochondral bone ossification, and impairedchondrocyte proliferation and sulfate uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Slc26a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slc26a2 APN 18 61198740 missense probably benign 0.05
IGL01570:Slc26a2 APN 18 61198260 missense possibly damaging 0.80
IGL01800:Slc26a2 APN 18 61201729 nonsense probably null
IGL02131:Slc26a2 APN 18 61198812 missense possibly damaging 0.69
IGL02277:Slc26a2 APN 18 61198980 missense probably damaging 1.00
IGL02438:Slc26a2 APN 18 61202217 missense possibly damaging 0.46
IGL03338:Slc26a2 APN 18 61198902 missense probably damaging 1.00
IGL03377:Slc26a2 APN 18 61198586 missense probably damaging 1.00
R0029:Slc26a2 UTSW 18 61202310 missense possibly damaging 0.73
R0531:Slc26a2 UTSW 18 61198379 missense probably damaging 1.00
R1929:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R2115:Slc26a2 UTSW 18 61198824 missense possibly damaging 0.71
R2272:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R2921:Slc26a2 UTSW 18 61201935 missense probably damaging 0.99
R4184:Slc26a2 UTSW 18 61198832 missense probably benign 0.01
R4812:Slc26a2 UTSW 18 61202021 missense probably damaging 1.00
R4948:Slc26a2 UTSW 18 61198258 nonsense probably null
R4960:Slc26a2 UTSW 18 61198803 missense probably damaging 1.00
R5107:Slc26a2 UTSW 18 61198560 missense probably damaging 1.00
R6120:Slc26a2 UTSW 18 61199417 missense possibly damaging 0.64
R6147:Slc26a2 UTSW 18 61201685 missense probably damaging 1.00
R6914:Slc26a2 UTSW 18 61199279 missense probably damaging 0.97
R6996:Slc26a2 UTSW 18 61201854 missense probably damaging 1.00
R7166:Slc26a2 UTSW 18 61198829 missense possibly damaging 0.88
R7529:Slc26a2 UTSW 18 61198358 missense probably damaging 1.00
R7609:Slc26a2 UTSW 18 61198460 missense probably benign 0.00
R7846:Slc26a2 UTSW 18 61198704 missense probably benign 0.00
R8208:Slc26a2 UTSW 18 61198734 missense probably damaging 1.00
X0003:Slc26a2 UTSW 18 61199195 missense probably damaging 0.99
Z1177:Slc26a2 UTSW 18 61199537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGGGTGGCATAAACC -3'
(R):5'- CAATGGGCTTCTTTCAAGTGGG -3'

Sequencing Primer
(F):5'- GTTTTCCAAAATGAGAAGCCAATGTG -3'
(R):5'- CAAGTGGGCTTTGTCTCTGTCTAC -3'
Posted On2015-12-21