Incidental Mutation 'R4765:Afg3l2'
ID366104
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene NameAFG3-like AAA ATPase 2
Synonyms2310036I02Rik, Emv66, par
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67404767-67449166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67421259 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On2015-12-21