Mutagenetix > Incidental Mutation

Incidental Mutation 'R4765:Rad9a'

366106

Institutional Source

Beutler Lab

Gene Symbol

Rad9a

Ensembl Gene

ENSMUSG00000024824

Gene Name

RAD9 checkpoint clamp component A

Synonyms

MMRRC Submission

042406-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4195198-4201603 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 4200489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 109 (V109L)

Ref Sequence

ENSEMBL: ENSMUSP00000025740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025740]

AlphaFold

Q9Z0F6

Predicted Effect

probably benign
Transcript: ENSMUST00000025740
AA Change: V109L

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824
AA Change: V109L

Domain	Start	End	E-Value	Type
Pfam:Rad9	13	265	6.6e-101	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a knock-out allele are consistently smaller and display abnormal embryonic development and midgestational lethality associated with increased apoptosis and reduced cellular proliferation. Mutant mouse embryonic fibroblasts are not viable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Bicc1	T	C	10: 70,940,593	T759A	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Mkl2	C	A	16: 13,412,594	P1048T	probably damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Scyl2	C	T	10: 89,659,298	V304I	probably damaging	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Snx19	A	C	9: 30,440,157	Q840H	probably damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,877	S129T	probably benign	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Ubr1	A	T	2: 120,963,442	L87*	probably null	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zfhx4	T	C	3: 5,400,152	L1790P	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Rad9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01411:Rad9a	APN	19	4201337	missense	probably benign	0.00
R0690:Rad9a	UTSW	19	4197360	splice site	probably null
R1167:Rad9a	UTSW	19	4197502	missense	possibly damaging	0.91
R1823:Rad9a	UTSW	19	4197242	missense	probably damaging	1.00
R3725:Rad9a	UTSW	19	4197695	missense	probably damaging	1.00
R4468:Rad9a	UTSW	19	4200294	missense	probably benign	0.08
R4694:Rad9a	UTSW	19	4200561	missense	probably damaging	1.00
R4695:Rad9a	UTSW	19	4200561	missense	probably damaging	1.00
R4742:Rad9a	UTSW	19	4200561	missense	probably damaging	1.00
R4743:Rad9a	UTSW	19	4200561	missense	probably damaging	1.00
R4824:Rad9a	UTSW	19	4200537	missense	probably benign
R4902:Rad9a	UTSW	19	4201553	start gained	probably benign
R5037:Rad9a	UTSW	19	4197174	missense	probably benign	0.00
R5346:Rad9a	UTSW	19	4201518	splice site	probably null
R7532:Rad9a	UTSW	19	4201523	start gained	probably benign
R9490:Rad9a	UTSW	19	4197548	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGCGAAGTTTGAAGCAG -3'
(R):5'- TGCAGACACCACAGCTTTG -3'

Sequencing Primer
(F):5'- CTGGGGTGCGCAATAAGTG -3'
(R):5'- ACAGCTTTGTGGGGCCAG -3'

Posted On

2015-12-21