Incidental Mutation 'R4766:Cdh19'
ID366114
Institutional Source Beutler Lab
Gene Symbol Cdh19
Ensembl Gene ENSMUSG00000047216
Gene Namecadherin 19, type 2
Synonyms
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location110888326-110977584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110893260 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 583 (K583E)
Ref Sequence ENSEMBL: ENSMUSP00000092210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094626]
Predicted Effect probably benign
Transcript: ENSMUST00000094626
AA Change: K583E

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092210
Gene: ENSMUSG00000047216
AA Change: K583E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 64 144 2.44e-14 SMART
CA 168 252 3.21e-23 SMART
CA 276 367 6.2e-7 SMART
CA 390 466 2.69e-16 SMART
CA 489 576 6.68e-3 SMART
transmembrane domain 594 616 N/A INTRINSIC
Pfam:Cadherin_C 619 764 1.7e-50 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related type II cadherin genes situated in a cluster on chromosome 18. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein containing five extracellular cadherin repeats. Loss of cadherins may be associated with cancer formation. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Cdh19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Cdh19 APN 1 110949252 missense probably damaging 1.00
IGL00863:Cdh19 APN 1 110949144 missense probably damaging 1.00
IGL01537:Cdh19 APN 1 110919611 missense possibly damaging 0.73
IGL02108:Cdh19 APN 1 110889731 missense probably benign 0.31
IGL02125:Cdh19 APN 1 110929884 missense possibly damaging 0.94
IGL02234:Cdh19 APN 1 110932226 missense probably damaging 1.00
IGL02251:Cdh19 APN 1 110954652 missense probably benign 0.00
IGL02275:Cdh19 APN 1 110925886 missense probably benign 0.21
IGL03203:Cdh19 APN 1 110890098 missense possibly damaging 0.82
R0539:Cdh19 UTSW 1 110925162 missense possibly damaging 0.81
R0594:Cdh19 UTSW 1 110925867 missense probably benign 0.40
R0612:Cdh19 UTSW 1 110893170 splice site probably benign
R1028:Cdh19 UTSW 1 110954584 missense probably benign 0.03
R1627:Cdh19 UTSW 1 110919645 missense probably benign 0.16
R1728:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1729:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1730:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1739:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1762:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1783:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1785:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1974:Cdh19 UTSW 1 110890159 missense possibly damaging 0.50
R2119:Cdh19 UTSW 1 110919590 missense probably benign 0.00
R3026:Cdh19 UTSW 1 110954688 missense probably benign 0.03
R3037:Cdh19 UTSW 1 110954607 missense probably damaging 1.00
R3612:Cdh19 UTSW 1 110893296 missense probably damaging 1.00
R4254:Cdh19 UTSW 1 110925030 missense probably damaging 1.00
R4368:Cdh19 UTSW 1 110889712 nonsense probably null
R4624:Cdh19 UTSW 1 110932251 missense probably benign 0.25
R4648:Cdh19 UTSW 1 110925177 missense probably benign 0.04
R4720:Cdh19 UTSW 1 110895381 critical splice donor site probably null
R4937:Cdh19 UTSW 1 110889964 missense probably damaging 1.00
R4968:Cdh19 UTSW 1 110925228 missense probably benign 0.08
R4970:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5095:Cdh19 UTSW 1 110954661 missense probably benign
R5112:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5586:Cdh19 UTSW 1 110929857 missense probably damaging 1.00
R6431:Cdh19 UTSW 1 110925057 missense probably benign 0.00
R6595:Cdh19 UTSW 1 110925787 missense probably benign 0.15
R6997:Cdh19 UTSW 1 110954866 start gained probably benign
R7240:Cdh19 UTSW 1 110893407 missense probably benign
Z1176:Cdh19 UTSW 1 110893306 missense probably benign 0.00
Z1176:Cdh19 UTSW 1 110895387 missense probably damaging 1.00
Z1176:Cdh19 UTSW 1 110932214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGATACTGTACTACAAAGAAGCTG -3'
(R):5'- GGTTTCTGTTTTAGATAACACAGCTG -3'

Sequencing Primer
(F):5'- AGAGTTCTCGAGGTCAATTCCCAG -3'
(R):5'- GCTGTAATTCTGAGTAATAGAACTGG -3'
Posted On2015-12-21