Incidental Mutation 'R4766:Mug1'
ID366143
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121884254 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1278 (T1278I)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably benign
Transcript: ENSMUST00000032228
AA Change: T1278I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: T1278I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204210
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7919:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7950:Mug1 UTSW 6 121873634 missense probably benign
R7987:Mug1 UTSW 6 121851465 missense probably benign
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCTGAAATAAAGTCTTGAGCTC -3'
(R):5'- ATTTTGGGGAAGAAGGCTCGC -3'

Sequencing Primer
(F):5'- CTCATGACAGCTTGTGAC -3'
(R):5'- AAGGCTCGCAGCTGCATAC -3'
Posted On2015-12-21