Incidental Mutation 'R4766:Mfge8'
ID366148
Institutional Source Beutler Lab
Gene Symbol Mfge8
Ensembl Gene ENSMUSG00000030605
Gene Namemilk fat globule-EGF factor 8 protein
SynonymsMFG-E8, Mfgm, EGF/factor VIII, lactadherin, SED1
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79133768-79149060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79134525 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 389 (N389D)
Ref Sequence ENSEMBL: ENSMUSP00000103032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032825] [ENSMUST00000032827] [ENSMUST00000107409] [ENSMUST00000205563] [ENSMUST00000205782] [ENSMUST00000206092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032825
AA Change: N426D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032825
Gene: ENSMUSG00000030605
AA Change: N426D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
low complexity region 123 138 N/A INTRINSIC
FA58C 147 303 1.94e-43 SMART
FA58C 307 463 1.24e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032827
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107409
AA Change: N389D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103032
Gene: ENSMUSG00000030605
AA Change: N389D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
FA58C 110 266 3.68e-44 SMART
FA58C 270 426 1.24e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205494
Predicted Effect probably benign
Transcript: ENSMUST00000205563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205649
Predicted Effect probably benign
Transcript: ENSMUST00000205782
Predicted Effect probably benign
Transcript: ENSMUST00000206092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206338
Meta Mutation Damage Score 0.2336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to form multiple protein products. The major encoded protein product, lactadherin, is a membrane glycoprotein that promotes phagocytosis of apoptotic cells. This protein has also been implicated in wound healing, autoimmune disease, and cancer. Lactadherin can be further processed to form a smaller cleavage product, medin, which comprises the major protein component of aortic medial amyloid (AMA). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility associated with impaired zona pellucida binding. Fertility is unaffected in female mutant mice. Splenomegaly occurs with age and defects occur in phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Mfge8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Mfge8 APN 7 79136782 missense probably damaging 1.00
IGL01751:Mfge8 APN 7 79136655 critical splice donor site probably null
IGL02023:Mfge8 APN 7 79145237 intron probably benign
IGL02112:Mfge8 APN 7 79143340 missense probably benign
IGL02669:Mfge8 APN 7 79145681 missense probably benign 0.36
IGL02978:Mfge8 APN 7 79141710 missense probably damaging 1.00
IGL02978:Mfge8 APN 7 79141728 missense possibly damaging 0.92
R1587:Mfge8 UTSW 7 79134765 missense probably damaging 1.00
R1657:Mfge8 UTSW 7 79141773 missense probably benign
R1716:Mfge8 UTSW 7 79142443 missense probably damaging 1.00
R5100:Mfge8 UTSW 7 79143300 missense probably benign 0.13
R6932:Mfge8 UTSW 7 79143301 missense probably benign
R7044:Mfge8 UTSW 7 79142520 missense probably benign 0.25
Z1177:Mfge8 UTSW 7 79145737 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAAGGTCGTCAGCCACAG -3'
(R):5'- CCACAGTGATGATGGTGTGC -3'

Sequencing Primer
(F):5'- CCACAGAAGGCAGCAGG -3'
(R):5'- TGCAGTGGACTGTATATGAGGAGC -3'
Posted On2015-12-21