Incidental Mutation 'R4766:Ccr8'
ID 366159
Institutional Source Beutler Lab
Gene Symbol Ccr8
Ensembl Gene ENSMUSG00000042262
Gene Name chemokine (C-C motif) receptor 8
Synonyms Cmkbr8
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4766 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 120092114-120094906 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120094464 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 215 (C215Y)
Ref Sequence ENSEMBL: ENSMUSP00000038473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048777]
AlphaFold P56484
Predicted Effect probably damaging
Transcript: ENSMUST00000048777
AA Change: C215Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: C215Y

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 313 2.4e-8 PFAM
Pfam:7tm_1 50 298 3.3e-44 PFAM
low complexity region 338 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217495
Meta Mutation Damage Score 0.9296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Ccr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Ccr8 APN 9 120094625 missense probably damaging 1.00
IGL02558:Ccr8 APN 9 120094658 missense probably benign 0.01
IGL02966:Ccr8 APN 9 120094140 missense probably damaging 0.96
IGL03135:Ccr8 APN 9 120094623 missense possibly damaging 0.89
R0402:Ccr8 UTSW 9 120094910 splice site probably null
R0739:Ccr8 UTSW 9 120094349 missense probably damaging 1.00
R1069:Ccr8 UTSW 9 120094217 missense probably benign 0.00
R4934:Ccr8 UTSW 9 120094749 missense probably benign
R5116:Ccr8 UTSW 9 120094029 missense probably benign 0.39
R5942:Ccr8 UTSW 9 120094706 missense probably damaging 0.99
R5957:Ccr8 UTSW 9 120093827 missense probably damaging 0.99
R5996:Ccr8 UTSW 9 120094463 missense probably damaging 1.00
R7223:Ccr8 UTSW 9 120094617 missense probably damaging 0.99
R8037:Ccr8 UTSW 9 120094370 missense probably benign
R8332:Ccr8 UTSW 9 120094374 missense probably damaging 1.00
R8962:Ccr8 UTSW 9 120094547 missense possibly damaging 0.56
R9344:Ccr8 UTSW 9 120094067 missense probably damaging 1.00
Z1177:Ccr8 UTSW 9 120094499 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CTATGCCATCAAGGTGAGGAC -3'
(R):5'- TGGCACATCCATCCAAGATG -3'

Sequencing Primer
(F):5'- AGCCCTGAGTCTGACAGTGTG -3'
(R):5'- ATCCATCCAAGATGTGCAGGTCG -3'
Posted On 2015-12-21