Incidental Mutation 'R4766:Erbb3'
ID 366165
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Name erb-b2 receptor tyrosine kinase 3
Synonyms Erbb3r, Erbb-3, HER3
MMRRC Submission 042407-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4766 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 128403392-128425504 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128422107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 46 (Y46H)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
AlphaFold Q61526
Predicted Effect possibly damaging
Transcript: ENSMUST00000082059
AA Change: Y46H

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: Y46H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184111
Meta Mutation Damage Score 0.4426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,245,502 (GRCm39) V1584I probably benign Het
Adamts12 A G 15: 11,285,987 (GRCm39) D732G probably benign Het
Agpat4 A G 17: 12,370,637 (GRCm39) probably benign Het
AI182371 T C 2: 34,985,829 (GRCm39) D140G possibly damaging Het
Apol11b T A 15: 77,519,133 (GRCm39) T316S probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bard1 T C 1: 71,114,333 (GRCm39) E216G probably benign Het
Bdp1 C A 13: 100,186,376 (GRCm39) R1692L probably damaging Het
Capn10 T C 1: 92,871,141 (GRCm39) I101T probably damaging Het
Ccdc175 C T 12: 72,158,979 (GRCm39) M653I probably benign Het
Ccdc9b C A 2: 118,590,058 (GRCm39) R262L probably damaging Het
Ccr8 G A 9: 119,923,530 (GRCm39) C215Y probably damaging Het
Cct3 T A 3: 88,219,092 (GRCm39) L241* probably null Het
Cd2ap A T 17: 43,163,350 (GRCm39) I25N probably damaging Het
Cdh19 T C 1: 110,820,990 (GRCm39) K583E probably benign Het
Cela3a A G 4: 137,129,986 (GRCm39) S212P unknown Het
Cfap44 T A 16: 44,236,246 (GRCm39) probably null Het
Clca3a1 A T 3: 144,455,473 (GRCm39) L440Q probably damaging Het
Crybg2 A G 4: 133,816,663 (GRCm39) Y1676C probably damaging Het
Dscam T C 16: 96,445,188 (GRCm39) D1501G probably benign Het
Eml6 C A 11: 29,755,757 (GRCm39) L832F probably benign Het
Enpp3 A G 10: 24,649,825 (GRCm39) L867P probably damaging Het
Fads3 T C 19: 10,033,384 (GRCm39) I342T possibly damaging Het
Flvcr1 A T 1: 190,753,303 (GRCm39) S290T probably benign Het
Fut9 A G 4: 25,799,191 (GRCm39) probably benign Het
Gad2 C T 2: 22,512,679 (GRCm39) A2V probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm10715 T G 9: 3,038,073 (GRCm39) probably benign Het
Herc1 T G 9: 66,349,211 (GRCm39) D2023E probably benign Het
Hsd3b3 A G 3: 98,649,801 (GRCm39) L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,078,302 (GRCm39) probably benign Het
Iqcf3 A G 9: 106,438,148 (GRCm39) probably null Het
Kcna4 G A 2: 107,126,888 (GRCm39) V541M probably damaging Het
Kcnj11 T C 7: 45,749,240 (GRCm39) T28A probably benign Het
Kcnmb2 T A 3: 32,236,016 (GRCm39) N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,374,535 (GRCm39) probably benign Het
Krt1c T C 15: 101,722,395 (GRCm39) E430G probably damaging Het
Lins1 C T 7: 66,360,389 (GRCm39) L384F possibly damaging Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mfge8 T C 7: 78,784,273 (GRCm39) N389D probably damaging Het
Mug1 C T 6: 121,861,213 (GRCm39) T1278I probably benign Het
Myh9 T C 15: 77,692,077 (GRCm39) M161V probably damaging Het
Myl7 T A 11: 5,848,171 (GRCm39) Y61F probably benign Het
Nlrp4d A T 7: 10,096,706 (GRCm39) unknown Het
Nol3 A G 8: 106,008,565 (GRCm39) probably null Het
Nup85 T A 11: 115,468,751 (GRCm39) probably null Het
Obscn T A 11: 58,903,568 (GRCm39) T7619S probably damaging Het
Or2t49 T A 11: 58,392,494 (GRCm39) N296I probably damaging Het
Or4k48 T C 2: 111,476,226 (GRCm39) M39V probably benign Het
Or52a24 C T 7: 103,381,457 (GRCm39) T108I possibly damaging Het
Or7g26 G A 9: 19,230,141 (GRCm39) V104I probably benign Het
Pax5 T A 4: 44,679,494 (GRCm39) I184F probably damaging Het
Pcdha7 T A 18: 37,107,560 (GRCm39) V195D probably damaging Het
Phf3 A T 1: 30,853,020 (GRCm39) probably benign Het
Pla2g15 G T 8: 106,889,703 (GRCm39) G325V probably damaging Het
Ppp1r21 T C 17: 88,880,043 (GRCm39) F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 (GRCm39) I965V probably benign Het
Ptpru A G 4: 131,548,275 (GRCm39) V74A probably damaging Het
Rif1 T A 2: 51,988,946 (GRCm39) Y780N probably damaging Het
Rps25 T A 9: 44,320,046 (GRCm39) Y23N possibly damaging Het
Ryr1 T C 7: 28,785,258 (GRCm39) D1811G probably damaging Het
Scamp5 T G 9: 57,359,319 (GRCm39) probably null Het
Senp1 T C 15: 97,943,777 (GRCm39) D602G probably damaging Het
Sh2b2 T G 5: 136,260,811 (GRCm39) D135A probably damaging Het
Slc26a8 G A 17: 28,857,635 (GRCm39) T836M probably benign Het
Slfn4 T G 11: 83,077,647 (GRCm39) I145S possibly damaging Het
Spag6l G A 16: 16,595,254 (GRCm39) T377I probably benign Het
Spdye4b T C 5: 143,182,089 (GRCm39) F129S probably damaging Het
Sspo G A 6: 48,447,514 (GRCm39) G2360E probably benign Het
Taar2 A T 10: 23,816,669 (GRCm39) I70F probably damaging Het
Taar7e A G 10: 23,914,464 (GRCm39) N318S probably damaging Het
Tor1a C A 2: 30,857,742 (GRCm39) R42L probably benign Het
Trdn A T 10: 33,350,502 (GRCm39) Q690H probably benign Het
Trim56 C A 5: 137,141,579 (GRCm39) V646L probably benign Het
Tspan15 T A 10: 62,027,323 (GRCm39) K165I probably benign Het
Usp24 A G 4: 106,273,245 (GRCm39) Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 (GRCm39) T76A probably damaging Het
Vps13c T A 9: 67,785,506 (GRCm39) probably null Het
Zfp512b T C 2: 181,226,888 (GRCm39) probably benign Het
Zyx C A 6: 42,333,093 (GRCm39) probably null Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128,406,852 (GRCm39) missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128,408,798 (GRCm39) missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128,405,237 (GRCm39) makesense probably null
IGL01981:Erbb3 APN 10 128,407,519 (GRCm39) missense probably benign 0.28
IGL02190:Erbb3 APN 10 128,406,879 (GRCm39) splice site probably null
IGL02329:Erbb3 APN 10 128,409,088 (GRCm39) missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128,415,393 (GRCm39) missense probably benign 0.02
IGL02478:Erbb3 APN 10 128,407,227 (GRCm39) nonsense probably null
IGL02502:Erbb3 APN 10 128,406,153 (GRCm39) missense probably benign
IGL02539:Erbb3 APN 10 128,420,174 (GRCm39) splice site probably null
IGL03187:Erbb3 APN 10 128,408,463 (GRCm39) splice site probably benign
I1329:Erbb3 UTSW 10 128,419,323 (GRCm39) missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128,410,248 (GRCm39) missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128,409,279 (GRCm39) critical splice donor site probably null
R0006:Erbb3 UTSW 10 128,409,279 (GRCm39) critical splice donor site probably null
R0078:Erbb3 UTSW 10 128,419,310 (GRCm39) missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128,408,439 (GRCm39) missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128,412,881 (GRCm39) missense probably benign 0.01
R0621:Erbb3 UTSW 10 128,422,094 (GRCm39) missense probably benign 0.00
R1222:Erbb3 UTSW 10 128,407,534 (GRCm39) missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128,407,073 (GRCm39) missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128,419,117 (GRCm39) missense probably benign 0.08
R1692:Erbb3 UTSW 10 128,407,594 (GRCm39) missense probably benign 0.19
R1875:Erbb3 UTSW 10 128,410,335 (GRCm39) missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128,422,094 (GRCm39) missense probably benign 0.00
R2219:Erbb3 UTSW 10 128,405,740 (GRCm39) missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128,419,562 (GRCm39) missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128,406,193 (GRCm39) missense probably benign
R4393:Erbb3 UTSW 10 128,408,639 (GRCm39) missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128,414,944 (GRCm39) missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128,408,639 (GRCm39) nonsense probably null
R4881:Erbb3 UTSW 10 128,412,816 (GRCm39) missense probably benign 0.00
R4974:Erbb3 UTSW 10 128,408,317 (GRCm39) missense probably benign
R5266:Erbb3 UTSW 10 128,405,505 (GRCm39) missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128,405,948 (GRCm39) nonsense probably null
R5481:Erbb3 UTSW 10 128,408,349 (GRCm39) missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128,419,054 (GRCm39) missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128,405,943 (GRCm39) missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128,405,716 (GRCm39) missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128,410,318 (GRCm39) missense probably benign
R7847:Erbb3 UTSW 10 128,407,058 (GRCm39) missense probably damaging 1.00
R8529:Erbb3 UTSW 10 128,419,069 (GRCm39) missense probably damaging 0.99
R8843:Erbb3 UTSW 10 128,414,325 (GRCm39) missense possibly damaging 0.82
R8988:Erbb3 UTSW 10 128,406,030 (GRCm39) missense probably damaging 1.00
R9336:Erbb3 UTSW 10 128,420,929 (GRCm39) missense probably benign 0.15
R9530:Erbb3 UTSW 10 128,410,291 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAAAAGATGGTCCCCAG -3'
(R):5'- TGCCAAATCAGTGCCCAAAG -3'

Sequencing Primer
(F):5'- TGGTCCCCAGAAAGGAAAAGCC -3'
(R):5'- CCAGCGTGGAAAAGTTCACATTTC -3'
Posted On 2015-12-21