Incidental Mutation 'R4766:Slfn4'
ID 366170
Institutional Source Beutler Lab
Gene Symbol Slfn4
Ensembl Gene ENSMUSG00000000204
Gene Name schlafen 4
Synonyms
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4766 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83175186-83190216 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 83186821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 145 (I145S)
Ref Sequence ENSEMBL: ENSMUSP00000132595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000208] [ENSMUST00000019130] [ENSMUST00000167596] [ENSMUST00000214041] [ENSMUST00000215472]
AlphaFold Q3UV66
Predicted Effect possibly damaging
Transcript: ENSMUST00000000208
AA Change: I145S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000208
Gene: ENSMUSG00000000204
AA Change: I145S

DomainStartEndE-ValueType
Pfam:AlbA_2 243 382 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019130
SMART Domains Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986

DomainStartEndE-ValueType
Pfam:AlbA_2 165 303 5.5e-11 PFAM
low complexity region 394 412 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167596
AA Change: I145S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132595
Gene: ENSMUSG00000000204
AA Change: I145S

DomainStartEndE-ValueType
Pfam:AAA_4 243 385 1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214041
Predicted Effect probably benign
Transcript: ENSMUST00000215472
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the Schlafen family. All members of this family contain a Schlafen box domain that lies near an AAA domain. This protein belongs to the group 2 subset of Schlafen proteins, which are defined by a molecular weight between 58 kDa and 68 kDa and by the presence of a SWADL domain that contains the sequence Ser-Trp-Ala-Asp-Leu. In malignant melanoma cells, gene expression is up-regulated in response to interferon alpha. In bone marrow-derived macrophages, expression of this gene is induced during activation by Toll-like receptor agonists and repressed during macrophage colony-stimulating factor-mediated differentiation. Myelopoiesis is disrupted by constitutive overexpression in myeloid-lineage cells. A pseudogene of this gene is found on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Slfn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Slfn4 APN 11 83186974 missense possibly damaging 0.94
IGL02455:Slfn4 APN 11 83186758 missense probably damaging 1.00
IGL02600:Slfn4 APN 11 83187006 missense possibly damaging 0.61
IGL03294:Slfn4 APN 11 83186574 missense probably benign 0.00
R0277:Slfn4 UTSW 11 83186951 missense probably damaging 0.96
R0323:Slfn4 UTSW 11 83186951 missense probably damaging 0.96
R0477:Slfn4 UTSW 11 83188681 missense probably benign 0.06
R1370:Slfn4 UTSW 11 83188806 missense probably damaging 1.00
R1449:Slfn4 UTSW 11 83188993 missense probably benign 0.00
R1757:Slfn4 UTSW 11 83185385 missense possibly damaging 0.47
R2392:Slfn4 UTSW 11 83185422 missense possibly damaging 0.77
R3738:Slfn4 UTSW 11 83185311 start codon destroyed probably null 0.02
R4025:Slfn4 UTSW 11 83187214 missense probably damaging 1.00
R4732:Slfn4 UTSW 11 83189282 unclassified probably benign
R4733:Slfn4 UTSW 11 83189282 unclassified probably benign
R4876:Slfn4 UTSW 11 83187018 missense probably benign 0.26
R4985:Slfn4 UTSW 11 83187207 missense probably damaging 0.98
R5033:Slfn4 UTSW 11 83186797 missense probably damaging 1.00
R5226:Slfn4 UTSW 11 83187549 missense possibly damaging 0.48
R5281:Slfn4 UTSW 11 83187199 missense probably damaging 1.00
R5337:Slfn4 UTSW 11 83189229 missense probably benign 0.35
R6207:Slfn4 UTSW 11 83189125 missense possibly damaging 0.82
R6237:Slfn4 UTSW 11 83189112 missense probably damaging 1.00
R6398:Slfn4 UTSW 11 83187174 missense possibly damaging 0.76
R7721:Slfn4 UTSW 11 83187563 splice site probably null
R7832:Slfn4 UTSW 11 83186593 missense probably damaging 0.96
R7975:Slfn4 UTSW 11 83187156 missense possibly damaging 0.79
R8092:Slfn4 UTSW 11 83189005 missense probably benign
R8233:Slfn4 UTSW 11 83187529 missense probably damaging 0.99
R8279:Slfn4 UTSW 11 83186656 missense possibly damaging 0.86
R8692:Slfn4 UTSW 11 83188883 missense possibly damaging 0.67
R8735:Slfn4 UTSW 11 83186944 missense probably damaging 0.99
R9035:Slfn4 UTSW 11 83186650 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCTGTCTGTAGGAGAAATCACAC -3'
(R):5'- GGATTTGAGGAACTGCACTGC -3'

Sequencing Primer
(F):5'- TCTGTAGGAGAAATCACACTCGGAG -3'
(R):5'- TGAGGAACTGCACTGCATCCG -3'
Posted On 2015-12-21