Incidental Mutation 'R4766:Ccdc175'
ID366173
Institutional Source Beutler Lab
Gene Symbol Ccdc175
Ensembl Gene ENSMUSG00000021086
Gene Namecoiled-coil domain containing 175
Synonyms
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72101300-72185029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72112205 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 653 (M653I)
Ref Sequence ENSEMBL: ENSMUSP00000021494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021494]
Predicted Effect probably benign
Transcript: ENSMUST00000021494
AA Change: M653I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021494
Gene: ENSMUSG00000021086
AA Change: M653I

DomainStartEndE-ValueType
coiled coil region 129 164 N/A INTRINSIC
coiled coil region 205 235 N/A INTRINSIC
coiled coil region 295 383 N/A INTRINSIC
low complexity region 470 490 N/A INTRINSIC
coiled coil region 517 537 N/A INTRINSIC
low complexity region 803 819 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Ccdc175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Ccdc175 APN 12 72131142 splice site probably benign
IGL01805:Ccdc175 APN 12 72129229 splice site probably benign
IGL01807:Ccdc175 APN 12 72159842 missense probably benign 0.02
IGL01985:Ccdc175 APN 12 72128278 nonsense probably null
IGL02719:Ccdc175 APN 12 72175125 missense probably damaging 0.97
IGL02944:Ccdc175 APN 12 72117893 missense probably benign 0.02
IGL03113:Ccdc175 APN 12 72144783 missense probably benign 0.00
IGL03143:Ccdc175 APN 12 72136058 missense probably benign 0.03
IGL03356:Ccdc175 APN 12 72139893 splice site probably null
R0009:Ccdc175 UTSW 12 72135965 missense possibly damaging 0.87
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0609:Ccdc175 UTSW 12 72157507 missense probably benign 0.07
R0706:Ccdc175 UTSW 12 72139948 missense probably benign 0.04
R0948:Ccdc175 UTSW 12 72131123 missense probably damaging 1.00
R1054:Ccdc175 UTSW 12 72178544 missense possibly damaging 0.85
R1166:Ccdc175 UTSW 12 72105932 missense probably damaging 1.00
R1481:Ccdc175 UTSW 12 72101948 unclassified probably benign
R1860:Ccdc175 UTSW 12 72105926 missense probably benign
R2077:Ccdc175 UTSW 12 72140020 missense possibly damaging 0.54
R3806:Ccdc175 UTSW 12 72180824 missense possibly damaging 0.72
R3879:Ccdc175 UTSW 12 72136018 missense probably damaging 1.00
R3887:Ccdc175 UTSW 12 72136048 missense possibly damaging 0.65
R4557:Ccdc175 UTSW 12 72128306 missense probably benign 0.08
R4585:Ccdc175 UTSW 12 72175179 missense possibly damaging 0.65
R4686:Ccdc175 UTSW 12 72112278 missense probably damaging 1.00
R4773:Ccdc175 UTSW 12 72136048 missense probably damaging 0.99
R4909:Ccdc175 UTSW 12 72159753 missense probably damaging 1.00
R4964:Ccdc175 UTSW 12 72180845 missense probably damaging 1.00
R5338:Ccdc175 UTSW 12 72184971 missense probably damaging 0.99
R5539:Ccdc175 UTSW 12 72144813 missense probably benign 0.00
R5897:Ccdc175 UTSW 12 72159804 missense probably benign 0.06
R6128:Ccdc175 UTSW 12 72129159 missense probably benign 0.07
R6520:Ccdc175 UTSW 12 72140030 missense probably damaging 0.98
R6523:Ccdc175 UTSW 12 72144791 missense probably benign 0.01
R6917:Ccdc175 UTSW 12 72184905 missense probably damaging 1.00
R7035:Ccdc175 UTSW 12 72155645 missense probably benign 0.01
R7097:Ccdc175 UTSW 12 72128409 splice site probably null
R7339:Ccdc175 UTSW 12 72136041 missense probably damaging 1.00
R7450:Ccdc175 UTSW 12 72155673 missense possibly damaging 0.93
R7481:Ccdc175 UTSW 12 72155624 missense probably benign 0.00
R7676:Ccdc175 UTSW 12 72102047 missense possibly damaging 0.57
R8045:Ccdc175 UTSW 12 72155902 intron probably benign
Z1088:Ccdc175 UTSW 12 72128379 missense probably benign 0.01
Z1176:Ccdc175 UTSW 12 72112308 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCAAGCTGAGCTCTGATGTTAG -3'
(R):5'- ATTCCGTGGTCAACTGGATGG -3'

Sequencing Primer
(F):5'- AAGCTGAGCTCTGATGTTAGAAGTTG -3'
(R):5'- TGGATACAGAGCCCGGTTCTG -3'
Posted On2015-12-21