Incidental Mutation 'R4766:Dscam'
ID 366185
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik, Down syndrome cell adhesion molecule
MMRRC Submission 042407-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4766 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 96392040-96971952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96445188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1501 (D1501G)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: D1501G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: D1501G

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.2267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,245,502 (GRCm39) V1584I probably benign Het
Adamts12 A G 15: 11,285,987 (GRCm39) D732G probably benign Het
Agpat4 A G 17: 12,370,637 (GRCm39) probably benign Het
AI182371 T C 2: 34,985,829 (GRCm39) D140G possibly damaging Het
Apol11b T A 15: 77,519,133 (GRCm39) T316S probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bard1 T C 1: 71,114,333 (GRCm39) E216G probably benign Het
Bdp1 C A 13: 100,186,376 (GRCm39) R1692L probably damaging Het
Capn10 T C 1: 92,871,141 (GRCm39) I101T probably damaging Het
Ccdc175 C T 12: 72,158,979 (GRCm39) M653I probably benign Het
Ccdc9b C A 2: 118,590,058 (GRCm39) R262L probably damaging Het
Ccr8 G A 9: 119,923,530 (GRCm39) C215Y probably damaging Het
Cct3 T A 3: 88,219,092 (GRCm39) L241* probably null Het
Cd2ap A T 17: 43,163,350 (GRCm39) I25N probably damaging Het
Cdh19 T C 1: 110,820,990 (GRCm39) K583E probably benign Het
Cela3a A G 4: 137,129,986 (GRCm39) S212P unknown Het
Cfap44 T A 16: 44,236,246 (GRCm39) probably null Het
Clca3a1 A T 3: 144,455,473 (GRCm39) L440Q probably damaging Het
Crybg2 A G 4: 133,816,663 (GRCm39) Y1676C probably damaging Het
Eml6 C A 11: 29,755,757 (GRCm39) L832F probably benign Het
Enpp3 A G 10: 24,649,825 (GRCm39) L867P probably damaging Het
Erbb3 A G 10: 128,422,107 (GRCm39) Y46H possibly damaging Het
Fads3 T C 19: 10,033,384 (GRCm39) I342T possibly damaging Het
Flvcr1 A T 1: 190,753,303 (GRCm39) S290T probably benign Het
Fut9 A G 4: 25,799,191 (GRCm39) probably benign Het
Gad2 C T 2: 22,512,679 (GRCm39) A2V probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm10715 T G 9: 3,038,073 (GRCm39) probably benign Het
Herc1 T G 9: 66,349,211 (GRCm39) D2023E probably benign Het
Hsd3b3 A G 3: 98,649,801 (GRCm39) L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,078,302 (GRCm39) probably benign Het
Iqcf3 A G 9: 106,438,148 (GRCm39) probably null Het
Kcna4 G A 2: 107,126,888 (GRCm39) V541M probably damaging Het
Kcnj11 T C 7: 45,749,240 (GRCm39) T28A probably benign Het
Kcnmb2 T A 3: 32,236,016 (GRCm39) N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,374,535 (GRCm39) probably benign Het
Krt1c T C 15: 101,722,395 (GRCm39) E430G probably damaging Het
Lins1 C T 7: 66,360,389 (GRCm39) L384F possibly damaging Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mfge8 T C 7: 78,784,273 (GRCm39) N389D probably damaging Het
Mug1 C T 6: 121,861,213 (GRCm39) T1278I probably benign Het
Myh9 T C 15: 77,692,077 (GRCm39) M161V probably damaging Het
Myl7 T A 11: 5,848,171 (GRCm39) Y61F probably benign Het
Nlrp4d A T 7: 10,096,706 (GRCm39) unknown Het
Nol3 A G 8: 106,008,565 (GRCm39) probably null Het
Nup85 T A 11: 115,468,751 (GRCm39) probably null Het
Obscn T A 11: 58,903,568 (GRCm39) T7619S probably damaging Het
Or2t49 T A 11: 58,392,494 (GRCm39) N296I probably damaging Het
Or4k48 T C 2: 111,476,226 (GRCm39) M39V probably benign Het
Or52a24 C T 7: 103,381,457 (GRCm39) T108I possibly damaging Het
Or7g26 G A 9: 19,230,141 (GRCm39) V104I probably benign Het
Pax5 T A 4: 44,679,494 (GRCm39) I184F probably damaging Het
Pcdha7 T A 18: 37,107,560 (GRCm39) V195D probably damaging Het
Phf3 A T 1: 30,853,020 (GRCm39) probably benign Het
Pla2g15 G T 8: 106,889,703 (GRCm39) G325V probably damaging Het
Ppp1r21 T C 17: 88,880,043 (GRCm39) F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 (GRCm39) I965V probably benign Het
Ptpru A G 4: 131,548,275 (GRCm39) V74A probably damaging Het
Rif1 T A 2: 51,988,946 (GRCm39) Y780N probably damaging Het
Rps25 T A 9: 44,320,046 (GRCm39) Y23N possibly damaging Het
Ryr1 T C 7: 28,785,258 (GRCm39) D1811G probably damaging Het
Scamp5 T G 9: 57,359,319 (GRCm39) probably null Het
Senp1 T C 15: 97,943,777 (GRCm39) D602G probably damaging Het
Sh2b2 T G 5: 136,260,811 (GRCm39) D135A probably damaging Het
Slc26a8 G A 17: 28,857,635 (GRCm39) T836M probably benign Het
Slfn4 T G 11: 83,077,647 (GRCm39) I145S possibly damaging Het
Spag6l G A 16: 16,595,254 (GRCm39) T377I probably benign Het
Spdye4b T C 5: 143,182,089 (GRCm39) F129S probably damaging Het
Sspo G A 6: 48,447,514 (GRCm39) G2360E probably benign Het
Taar2 A T 10: 23,816,669 (GRCm39) I70F probably damaging Het
Taar7e A G 10: 23,914,464 (GRCm39) N318S probably damaging Het
Tor1a C A 2: 30,857,742 (GRCm39) R42L probably benign Het
Trdn A T 10: 33,350,502 (GRCm39) Q690H probably benign Het
Trim56 C A 5: 137,141,579 (GRCm39) V646L probably benign Het
Tspan15 T A 10: 62,027,323 (GRCm39) K165I probably benign Het
Usp24 A G 4: 106,273,245 (GRCm39) Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 (GRCm39) T76A probably damaging Het
Vps13c T A 9: 67,785,506 (GRCm39) probably null Het
Zfp512b T C 2: 181,226,888 (GRCm39) probably benign Het
Zyx C A 6: 42,333,093 (GRCm39) probably null Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96,409,265 (GRCm39) missense possibly damaging 0.64
IGL00841:Dscam APN 16 96,621,077 (GRCm39) missense probably damaging 1.00
IGL01289:Dscam APN 16 96,445,082 (GRCm39) nonsense probably null
IGL01358:Dscam APN 16 96,411,543 (GRCm39) missense possibly damaging 0.68
IGL01431:Dscam APN 16 96,453,278 (GRCm39) critical splice donor site probably null
IGL01444:Dscam APN 16 96,474,909 (GRCm39) missense possibly damaging 0.95
IGL01767:Dscam APN 16 96,456,136 (GRCm39) missense probably damaging 1.00
IGL01866:Dscam APN 16 96,486,550 (GRCm39) missense probably benign 0.06
IGL02020:Dscam APN 16 96,517,269 (GRCm39) missense probably damaging 1.00
IGL02023:Dscam APN 16 96,602,397 (GRCm39) missense probably benign 0.06
IGL02057:Dscam APN 16 96,517,273 (GRCm39) nonsense probably null
IGL02389:Dscam APN 16 96,442,097 (GRCm39) missense probably benign 0.27
IGL02409:Dscam APN 16 96,621,088 (GRCm39) missense possibly damaging 0.46
IGL02694:Dscam APN 16 96,394,476 (GRCm39) missense probably benign 0.00
IGL02899:Dscam APN 16 96,510,447 (GRCm39) missense probably damaging 0.98
IGL02956:Dscam APN 16 96,602,472 (GRCm39) missense probably damaging 0.98
IGL03035:Dscam APN 16 96,621,170 (GRCm39) missense possibly damaging 0.94
IGL03191:Dscam APN 16 96,621,969 (GRCm39) missense probably benign 0.36
growler UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
Twostep UTSW 16 96,626,982 (GRCm39) splice site probably null
F6893:Dscam UTSW 16 96,857,660 (GRCm39) missense possibly damaging 0.78
K3955:Dscam UTSW 16 96,474,887 (GRCm39) missense probably benign 0.00
R0024:Dscam UTSW 16 96,394,585 (GRCm39) nonsense probably null
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0117:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R0211:Dscam UTSW 16 96,517,279 (GRCm39) missense possibly damaging 0.50
R0280:Dscam UTSW 16 96,840,206 (GRCm39) missense possibly damaging 0.62
R0355:Dscam UTSW 16 96,456,105 (GRCm39) missense probably benign 0.00
R0380:Dscam UTSW 16 96,857,810 (GRCm39) missense probably damaging 1.00
R0445:Dscam UTSW 16 96,573,703 (GRCm39) missense probably damaging 1.00
R0492:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0534:Dscam UTSW 16 96,453,372 (GRCm39) missense possibly damaging 0.67
R0593:Dscam UTSW 16 96,573,608 (GRCm39) missense probably benign 0.19
R0707:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0738:Dscam UTSW 16 96,620,981 (GRCm39) missense possibly damaging 0.48
R1017:Dscam UTSW 16 96,634,633 (GRCm39) missense probably damaging 1.00
R1377:Dscam UTSW 16 96,573,694 (GRCm39) missense probably damaging 1.00
R1440:Dscam UTSW 16 96,621,151 (GRCm39) missense probably damaging 1.00
R1442:Dscam UTSW 16 96,409,274 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1478:Dscam UTSW 16 96,592,110 (GRCm39) missense probably benign 0.15
R1530:Dscam UTSW 16 96,621,074 (GRCm39) missense probably damaging 1.00
R1731:Dscam UTSW 16 96,621,076 (GRCm39) missense probably damaging 1.00
R1765:Dscam UTSW 16 96,486,579 (GRCm39) missense probably benign 0.00
R1824:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign 0.00
R1933:Dscam UTSW 16 96,394,414 (GRCm39) missense probably benign 0.00
R2005:Dscam UTSW 16 96,840,120 (GRCm39) missense probably benign 0.02
R2006:Dscam UTSW 16 96,621,112 (GRCm39) missense probably damaging 1.00
R2101:Dscam UTSW 16 96,411,549 (GRCm39) missense probably benign 0.00
R2177:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 0.98
R2342:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R2851:Dscam UTSW 16 96,423,915 (GRCm39) missense possibly damaging 0.94
R2929:Dscam UTSW 16 96,486,612 (GRCm39) missense possibly damaging 0.76
R3055:Dscam UTSW 16 96,602,555 (GRCm39) missense probably damaging 1.00
R3157:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3159:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3944:Dscam UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
R4080:Dscam UTSW 16 96,484,972 (GRCm39) missense probably benign 0.01
R4285:Dscam UTSW 16 96,510,309 (GRCm39) critical splice donor site probably null
R4384:Dscam UTSW 16 96,510,416 (GRCm39) missense probably damaging 0.99
R4460:Dscam UTSW 16 96,411,519 (GRCm39) missense probably damaging 1.00
R4575:Dscam UTSW 16 96,626,823 (GRCm39) missense possibly damaging 0.82
R4594:Dscam UTSW 16 96,519,196 (GRCm39) missense possibly damaging 0.78
R4643:Dscam UTSW 16 96,486,501 (GRCm39) missense probably damaging 0.96
R4698:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R4716:Dscam UTSW 16 96,420,771 (GRCm39) missense possibly damaging 0.80
R4743:Dscam UTSW 16 96,631,256 (GRCm39) missense probably benign 0.00
R4899:Dscam UTSW 16 96,485,018 (GRCm39) missense probably benign 0.01
R4987:Dscam UTSW 16 96,498,721 (GRCm39) missense probably benign 0.00
R4990:Dscam UTSW 16 96,626,715 (GRCm39) missense probably benign 0.12
R5123:Dscam UTSW 16 96,573,637 (GRCm39) missense probably damaging 1.00
R5130:Dscam UTSW 16 96,620,979 (GRCm39) missense probably benign 0.00
R5328:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R5666:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5670:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5678:Dscam UTSW 16 96,592,100 (GRCm39) missense probably benign 0.16
R5827:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R5907:Dscam UTSW 16 96,622,120 (GRCm39) missense probably damaging 0.97
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6103:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign
R6240:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R6257:Dscam UTSW 16 96,474,914 (GRCm39) missense possibly damaging 0.94
R6361:Dscam UTSW 16 96,424,011 (GRCm39) missense probably benign 0.08
R6405:Dscam UTSW 16 96,479,625 (GRCm39) missense probably damaging 1.00
R6444:Dscam UTSW 16 96,420,844 (GRCm39) missense probably damaging 1.00
R6560:Dscam UTSW 16 96,626,935 (GRCm39) missense probably benign 0.00
R6598:Dscam UTSW 16 96,620,984 (GRCm39) missense probably damaging 1.00
R6622:Dscam UTSW 16 96,446,273 (GRCm39) missense probably benign 0.06
R6792:Dscam UTSW 16 96,449,437 (GRCm39) missense probably damaging 1.00
R6792:Dscam UTSW 16 96,394,455 (GRCm39) missense probably damaging 0.96
R6827:Dscam UTSW 16 96,840,191 (GRCm39) missense probably damaging 1.00
R6868:Dscam UTSW 16 96,631,140 (GRCm39) missense probably damaging 1.00
R6898:Dscam UTSW 16 96,631,100 (GRCm39) missense probably benign 0.02
R6903:Dscam UTSW 16 96,621,988 (GRCm39) missense probably damaging 1.00
R7051:Dscam UTSW 16 96,620,986 (GRCm39) missense probably benign 0.01
R7146:Dscam UTSW 16 96,631,117 (GRCm39) nonsense probably null
R7180:Dscam UTSW 16 96,626,764 (GRCm39) missense probably damaging 0.97
R7209:Dscam UTSW 16 96,451,544 (GRCm39) splice site probably null
R7247:Dscam UTSW 16 96,622,008 (GRCm39) missense probably damaging 0.99
R7269:Dscam UTSW 16 96,479,601 (GRCm39) missense probably benign 0.00
R7301:Dscam UTSW 16 96,857,732 (GRCm39) missense probably benign 0.01
R7328:Dscam UTSW 16 96,446,235 (GRCm39) nonsense probably null
R7368:Dscam UTSW 16 96,445,131 (GRCm39) missense probably benign 0.00
R7425:Dscam UTSW 16 96,430,598 (GRCm39) missense probably damaging 1.00
R7474:Dscam UTSW 16 96,621,089 (GRCm39) missense possibly damaging 0.88
R7536:Dscam UTSW 16 96,442,226 (GRCm39) splice site probably null
R7624:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R7766:Dscam UTSW 16 96,592,101 (GRCm39) missense probably benign 0.31
R7817:Dscam UTSW 16 96,442,064 (GRCm39) missense probably benign
R7843:Dscam UTSW 16 96,626,830 (GRCm39) missense probably damaging 0.99
R7911:Dscam UTSW 16 96,445,122 (GRCm39) missense probably benign 0.01
R8108:Dscam UTSW 16 96,445,079 (GRCm39) missense probably benign 0.01
R8128:Dscam UTSW 16 96,602,374 (GRCm39) splice site probably null
R8770:Dscam UTSW 16 96,456,106 (GRCm39) missense possibly damaging 0.50
R8876:Dscam UTSW 16 96,420,828 (GRCm39) missense probably damaging 0.96
R9005:Dscam UTSW 16 96,602,580 (GRCm39) missense probably damaging 1.00
R9009:Dscam UTSW 16 96,840,116 (GRCm39) missense probably benign 0.10
R9168:Dscam UTSW 16 96,420,768 (GRCm39) missense possibly damaging 0.82
R9176:Dscam UTSW 16 96,486,553 (GRCm39) missense probably benign 0.37
R9244:Dscam UTSW 16 96,486,429 (GRCm39) missense possibly damaging 0.62
R9339:Dscam UTSW 16 96,517,263 (GRCm39) missense possibly damaging 0.89
R9374:Dscam UTSW 16 96,857,857 (GRCm39) missense probably benign 0.19
R9385:Dscam UTSW 16 96,840,203 (GRCm39) missense probably benign
R9674:Dscam UTSW 16 96,442,036 (GRCm39) missense probably benign 0.03
X0025:Dscam UTSW 16 96,510,361 (GRCm39) missense probably damaging 1.00
Z1088:Dscam UTSW 16 96,573,761 (GRCm39) missense probably benign 0.01
Z1177:Dscam UTSW 16 96,409,389 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAGTTGGCTTGCTTCTCCG -3'
(R):5'- CAAGGCTTTGTTCCTGCTG -3'

Sequencing Primer
(F):5'- GGCTTGCTTCTCCGCACAG -3'
(R):5'- TGGTGATCCAGCCTGGG -3'
Posted On 2015-12-21