Incidental Mutation 'R4767:Plaa'
ID366205
Institutional Source Beutler Lab
Gene Symbol Plaa
Ensembl Gene ENSMUSG00000028577
Gene Namephospholipase A2, activating protein
SynonymsD4Ertd618e, Ufd3
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location94567514-94603244 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 94586258 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000107107]
Predicted Effect probably benign
Transcript: ENSMUST00000107107
SMART Domains Protein: ENSMUSP00000102724
Gene: ENSMUSG00000028577

DomainStartEndE-ValueType
WD40 7 47 4.46e-1 SMART
WD40 54 98 8.49e-3 SMART
WD40 101 139 1.72e-3 SMART
WD40 140 179 8.81e-10 SMART
WD40 180 218 3.22e-3 SMART
WD40 220 259 7.33e-7 SMART
WD40 260 298 6.79e-2 SMART
Pfam:PFU 345 459 2.3e-43 PFAM
Pfam:PUL 535 789 1.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127656
SMART Domains Protein: ENSMUSP00000116530
Gene: ENSMUSG00000028577

DomainStartEndE-ValueType
Pfam:PFU 1 89 2.6e-34 PFAM
Pfam:PUL 142 214 7.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146118
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype PHENOTYPE: Homozygous KO is embryonic lethal. A hypomorphic homozygous point mutation affects neuromuscular junctions and Purkinje cell development, causing early-onset neurodysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Plaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Plaa APN 4 94582607 missense probably benign 0.00
IGL01089:Plaa APN 4 94574047 missense probably benign
IGL01695:Plaa APN 4 94574037 nonsense probably null
IGL01984:Plaa APN 4 94571685 unclassified probably null
IGL02430:Plaa APN 4 94582573 missense probably benign 0.09
IGL02552:Plaa APN 4 94582480 critical splice donor site probably null
IGL03238:Plaa APN 4 94583896 missense probably benign 0.23
R1353:Plaa UTSW 4 94571689 missense possibly damaging 0.69
R2937:Plaa UTSW 4 94569459 missense probably damaging 1.00
R3076:Plaa UTSW 4 94569805 missense probably benign
R3078:Plaa UTSW 4 94569805 missense probably benign
R3801:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3802:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3804:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3836:Plaa UTSW 4 94586922 critical splice acceptor site probably null
R4855:Plaa UTSW 4 94586408 missense probably damaging 1.00
R4978:Plaa UTSW 4 94589932 missense possibly damaging 0.81
R5284:Plaa UTSW 4 94569637 missense probably benign 0.03
R5557:Plaa UTSW 4 94584007 unclassified probably null
R5834:Plaa UTSW 4 94583469 missense probably damaging 1.00
R5856:Plaa UTSW 4 94583487 missense probably benign 0.00
R6053:Plaa UTSW 4 94589884 missense probably benign 0.00
R6145:Plaa UTSW 4 94583992 missense probably damaging 0.99
R6646:Plaa UTSW 4 94589978 missense probably benign
R7008:Plaa UTSW 4 94569349 makesense probably null
R7058:Plaa UTSW 4 94569823 nonsense probably null
R7078:Plaa UTSW 4 94574051 missense probably benign
R7120:Plaa UTSW 4 94582682 missense possibly damaging 0.91
R7651:Plaa UTSW 4 94582639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGAACATTCACTTCTAAAGGG -3'
(R):5'- GTGACCACTGCAGAAGACAG -3'

Sequencing Primer
(F):5'- CTTCTCCAGAAAGTTTTTCCATAGAG -3'
(R):5'- ACTGCAGAAGACAGATCTCTAAG -3'
Posted On2015-12-21