Incidental Mutation 'R0410:Gart'
ID36621
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 038612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0410 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91641327 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 101 (A101S)
Ref Sequence ENSEMBL: ENSMUSP00000156142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000120450] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000231444] [ENSMUST00000232289] [ENSMUST00000232367]
Predicted Effect probably damaging
Transcript: ENSMUST00000023684
AA Change: A101S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: A101S

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120450
AA Change: A101S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962
AA Change: A101S

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156713
AA Change: A101S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962
AA Change: A101S

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231380
AA Change: A101S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000231444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231863
Predicted Effect probably damaging
Transcript: ENSMUST00000232289
AA Change: A101S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000232367
AA Change: A101S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,732 D170G probably benign Het
Actrt3 C T 3: 30,598,124 G274S probably benign Het
Adamts18 G T 8: 113,714,358 C889* probably null Het
AF529169 T G 9: 89,602,203 E380D probably damaging Het
Alkbh6 C T 7: 30,312,606 P104S probably damaging Het
Alms1 A T 6: 85,587,803 E53V unknown Het
Ap3s1 T C 18: 46,779,212 C100R probably benign Het
Apbb2 G T 5: 66,451,806 A166E possibly damaging Het
Asph A G 4: 9,595,415 V174A probably damaging Het
Cacna2d2 T C 9: 107,524,620 L758P probably damaging Het
Cacng5 A G 11: 107,877,369 S271P possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Chn1 A T 2: 73,631,750 C236* probably null Het
Coro1b T C 19: 4,149,363 V7A probably damaging Het
Dhx16 A G 17: 35,890,967 Y962C probably damaging Het
Dixdc1 T C 9: 50,684,853 D152G probably damaging Het
Dmrt1 T C 19: 25,506,103 S84P probably damaging Het
Dnah10 A G 5: 124,755,735 D844G probably benign Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Efcab7 T C 4: 99,878,285 probably null Het
Fam83g A G 11: 61,703,392 D584G probably damaging Het
Fbxo7 T A 10: 86,029,238 probably null Het
Ffar1 T C 7: 30,860,630 T281A probably benign Het
Fntb T C 12: 76,888,052 V201A probably benign Het
Gbp9 T C 5: 105,085,073 T238A probably benign Het
Hectd4 T C 5: 121,286,266 L663S possibly damaging Het
Helz2 A T 2: 181,230,593 V2512E probably damaging Het
Hip1 A C 5: 135,458,155 L66R probably damaging Het
Iigp1 T A 18: 60,390,303 D164E probably benign Het
Kcnip3 A G 2: 127,460,066 S193P probably damaging Het
Klra9 T A 6: 130,188,744 T103S probably benign Het
Meis2 T C 2: 115,864,228 *471W probably null Het
Mrpl21 T C 19: 3,284,792 S45P possibly damaging Het
Mterf1b A G 5: 4,196,488 E43G probably benign Het
Mycbp2 G T 14: 103,135,133 S4092R probably damaging Het
Nfatc3 A T 8: 106,096,196 N538I probably damaging Het
Nphp4 T C 4: 152,557,046 C1095R probably benign Het
Npm2 T A 14: 70,652,553 T13S probably benign Het
Olfr24 C A 9: 18,754,841 V265F probably damaging Het
Olfr872 T A 9: 20,260,501 F220L probably benign Het
Plcg2 A T 8: 117,615,373 I1158F probably damaging Het
Popdc3 T C 10: 45,317,733 V210A possibly damaging Het
Postn T C 3: 54,385,277 L755S possibly damaging Het
Prdx6b T C 2: 80,293,029 F61L probably damaging Het
Rars C T 11: 35,826,020 R223H probably damaging Het
Robo1 G A 16: 72,971,984 G479D possibly damaging Het
Scaf4 A G 16: 90,260,170 Y98H unknown Het
Scn4a A G 11: 106,323,949 I1274T probably damaging Het
Senp2 G T 16: 22,009,694 R18L probably damaging Het
Six5 T A 7: 19,096,456 V336D probably damaging Het
Slc31a2 G A 4: 62,292,653 E8K probably benign Het
Slc4a7 A T 14: 14,738,299 T184S probably damaging Het
Slco2a1 T A 9: 103,073,314 probably null Het
Smr3a T G 5: 88,008,211 probably benign Het
Sqor T C 2: 122,787,522 V100A probably benign Het
Srarp T C 4: 141,433,148 N125D possibly damaging Het
Stam T C 2: 14,138,991 V364A probably benign Het
Tgm5 T C 2: 121,077,558 I46V possibly damaging Het
Tie1 A T 4: 118,480,569 V443E probably damaging Het
Tipin T C 9: 64,288,115 M1T probably null Het
Tnc T C 4: 64,007,694 T950A probably benign Het
Tns3 T C 11: 8,435,852 D1382G probably benign Het
Tor1aip1 A G 1: 156,035,940 V99A possibly damaging Het
Trim16 C T 11: 62,820,471 probably benign Het
Ttn G T 2: 76,788,357 N14448K possibly damaging Het
Ttn C T 2: 76,886,860 probably benign Het
Vmn1r23 A G 6: 57,926,190 I201T probably benign Het
Vmn2r13 T A 5: 109,173,813 K339N probably benign Het
Yap1 A G 9: 8,001,467 Y173H probably damaging Het
Zcchc11 A G 4: 108,486,555 R255G probably benign Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 splice site probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
R8209:Gart UTSW 16 91628153 missense possibly damaging 0.78
R8824:Gart UTSW 16 91630703 missense possibly damaging 0.64
R8840:Gart UTSW 16 91636122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- gggctgCCTGGCAACtttttttttt -3'
(R):5'- CTCGCTTGTCCACGAGGATTTGTA -3'

Sequencing Primer
(F):5'- GTGACTTTTTGCCCACCTTG -3'
(R):5'- GAGAAGAGGAGCTTTCATCCCTT -3'
Posted On2013-05-09