Mutagenetix > Incidental Mutation

Incidental Mutation 'R4767:Trpc6'

366218

Institutional Source

Beutler Lab

Gene Symbol

Trpc6

Ensembl Gene

ENSMUSG00000031997

Gene Name

transient receptor potential cation channel, subfamily C, member 6

Synonyms

mtrp6, Trrp6

MMRRC Submission

042408-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4767 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8544142-8680741 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8643686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 491 (S491P)

Ref Sequence

ENSEMBL: ENSMUSP00000149686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596]

AlphaFold

Q61143

Predicted Effect

probably damaging
Transcript: ENSMUST00000050433
AA Change: S491P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: S491P

Domain	Start	End	E-Value	Type
low complexity region	37	54	N/A	INTRINSIC
ANK	96	125	4.73e2	SMART
ANK	131	159	3.49e0	SMART
ANK	217	246	6.61e-1	SMART
Pfam:TRP_2	252	314	4e-29	PFAM
transmembrane domain	406	427	N/A	INTRINSIC
Pfam:Ion_trans	442	738	4.2e-38	PFAM
Pfam:PKD_channel	477	733	3.1e-16	PFAM
low complexity region	770	781	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214596
AA Change: S491P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215328

Meta Mutation Damage Score

0.4493

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	C	11: 46,138,977		probably null	Het
Aig1	T	C	10: 13,801,858	N130S	probably damaging	Het
Alx1	A	T	10: 103,025,186	Y160*	probably null	Het
Ap4e1	T	C	2: 127,060,438	I755T	probably benign	Het
Apoc3	C	A	9: 46,234,535	E21*	probably null	Het
Atp9b	G	T	18: 80,753,070	H919Q	probably damaging	Het
Cemip	T	G	7: 83,973,306	Y555S	probably damaging	Het
Cic	T	C	7: 25,271,600	V252A	possibly damaging	Het
Cracr2a	A	T	6: 127,611,507	N210Y	probably damaging	Het
Crocc2	G	A	1: 93,202,856	R953Q	possibly damaging	Het
Csnk1d	A	G	11: 120,969,128	S318P	probably benign	Het
Ddx21	A	G	10: 62,591,972	L384P	probably damaging	Het
Dnah5	C	T	15: 28,270,474	T974I	probably benign	Het
Duox1	A	G	2: 122,333,441	Y863C	possibly damaging	Het
Epg5	C	A	18: 78,023,283	P2133T	possibly damaging	Het
Ephb6	A	T	6: 41,614,185	Q92L	possibly damaging	Het
Ercc4	C	A	16: 13,122,095	A73D	probably damaging	Het
Eva1c	A	T	16: 90,904,347	Y290F	probably damaging	Het
Galnt5	T	A	2: 58,028,144	V798E	possibly damaging	Het
Haus4	T	C	14: 54,548,885	E149G	probably damaging	Het
Ighv1-13	A	G	12: 114,630,936	Y86C	unknown	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Lama3	T	C	18: 12,500,563	V1584A	probably benign	Het
Lamb1	A	G	12: 31,308,011	E1119G	probably damaging	Het
Lao1	T	C	4: 118,967,988	L335P	probably damaging	Het
Mindy4	A	G	6: 55,260,565	D375G	probably damaging	Het
Myo5a	T	C	9: 75,144,076	I317T	probably damaging	Het
Nhlrc2	G	A	19: 56,570,466	V128I	probably benign	Het
Nlrp2	C	T	7: 5,328,024	D458N	probably damaging	Het
Olfr107	T	A	17: 37,406,200	C217*	probably null	Het
Olfr1497	A	T	19: 13,795,045	C189S	probably damaging	Het
Olfr347	A	T	2: 36,734,323	M1L	probably benign	Het
Olfr76	G	T	19: 12,119,936	H247N	probably damaging	Het
Olfr938	T	C	9: 39,078,692	T18A	possibly damaging	Het
Parp8	T	C	13: 116,868,536	H663R	probably damaging	Het
Pax6	T	C	2: 105,695,360	S377P	probably benign	Het
Pi15	A	G	1: 17,602,766	D63G	probably benign	Het
Plaa	A	G	4: 94,586,258		probably benign	Het
Rbm5	C	A	9: 107,745,213	W546C	probably damaging	Het
Rnf123	C	A	9: 108,052,089	C1257F	probably damaging	Het
Rnf185	A	G	11: 3,432,551	S45P	possibly damaging	Het
Sh3bp1	T	C	15: 78,904,497	S241P	possibly damaging	Het
Slfn8	G	A	11: 83,003,197	A872V	possibly damaging	Het
Smoc1	G	A	12: 81,104,773		probably null	Het
Sox14	A	T	9: 99,875,633	W18R	probably damaging	Het
Spata31d1a	T	C	13: 59,701,155	E1053G	probably benign	Het
Syne1	T	A	10: 5,344,866	K1246*	probably null	Het
Tbrg4	A	C	11: 6,620,909	S188A	probably benign	Het
Thnsl2	A	T	6: 71,134,295	D196E	probably damaging	Het
Tmem266	C	T	9: 55,380,741	T34I	probably damaging	Het
Tmem59l	C	A	8: 70,486,098	R111L	probably benign	Het
Tpr	T	C	1: 150,430,529		probably benign	Het
Tspan10	A	T	11: 120,446,166	N254I	probably damaging	Het
Ubox5	A	T	2: 130,591,894	L511Q	probably damaging	Het
Vmn1r183	TATCCATC	TATC	7: 24,055,106		probably null	Het
Vmn2r4	C	T	3: 64,390,976	C577Y	probably damaging	Het
Vmn2r86	A	T	10: 130,455,737	M53K	probably benign	Het
Zfp948	T	A	17: 21,588,307	I587N	possibly damaging	Het

Other mutations in Trpc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Trpc6	APN	9	8680438	missense	probably damaging	1.00
IGL00469:Trpc6	APN	9	8626701	missense	probably benign
IGL00970:Trpc6	APN	9	8653151	missense	probably damaging	1.00
IGL01299:Trpc6	APN	9	8653061	missense	probably damaging	1.00
IGL01563:Trpc6	APN	9	8656603	missense	probably damaging	1.00
IGL01578:Trpc6	APN	9	8634057	missense	probably damaging	1.00
IGL02657:Trpc6	APN	9	8643601	missense	possibly damaging	0.94
IGL02735:Trpc6	APN	9	8655338	missense	probably damaging	1.00
IGL03102:Trpc6	APN	9	8649301	missense	probably benign	0.07
P0038:Trpc6	UTSW	9	8649511	missense	possibly damaging	0.52
PIT4531001:Trpc6	UTSW	9	8610148	missense	probably benign	0.14
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8610275	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8643536	missense	probably damaging	1.00
R0334:Trpc6	UTSW	9	8610343	missense	probably damaging	1.00
R0665:Trpc6	UTSW	9	8634122	missense	probably benign	0.11
R0948:Trpc6	UTSW	9	8610415	missense	possibly damaging	0.60
R1177:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1217:Trpc6	UTSW	9	8658286	splice site	probably null
R1445:Trpc6	UTSW	9	8680537	missense	probably benign	0.00
R1452:Trpc6	UTSW	9	8653147	missense	probably damaging	0.99
R1494:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1501:Trpc6	UTSW	9	8610169	missense	probably damaging	0.99
R1933:Trpc6	UTSW	9	8656545	missense	probably damaging	1.00
R2112:Trpc6	UTSW	9	8656612	missense	probably damaging	1.00
R2164:Trpc6	UTSW	9	8610465	nonsense	probably null
R2921:Trpc6	UTSW	9	8653033	missense	possibly damaging	0.94
R2995:Trpc6	UTSW	9	8544466	missense	probably benign	0.30
R3821:Trpc6	UTSW	9	8610278	missense	probably damaging	1.00
R3965:Trpc6	UTSW	9	8626621	missense	probably damaging	1.00
R4360:Trpc6	UTSW	9	8610266	missense	probably benign	0.10
R4625:Trpc6	UTSW	9	8677962	missense	probably benign	0.40
R4691:Trpc6	UTSW	9	8652978	missense	probably damaging	1.00
R4736:Trpc6	UTSW	9	8609870	missense	probably damaging	1.00
R4773:Trpc6	UTSW	9	8609851	missense	possibly damaging	0.78
R4792:Trpc6	UTSW	9	8626614	missense	probably benign	0.00
R5105:Trpc6	UTSW	9	8649470	missense	probably benign
R5319:Trpc6	UTSW	9	8609921	missense	probably damaging	1.00
R5429:Trpc6	UTSW	9	8634074	nonsense	probably null
R5505:Trpc6	UTSW	9	8626735	missense	probably damaging	1.00
R5657:Trpc6	UTSW	9	8609807	missense	probably benign	0.11
R5684:Trpc6	UTSW	9	8653128	missense	probably damaging	1.00
R5722:Trpc6	UTSW	9	8680549	missense	possibly damaging	0.88
R6210:Trpc6	UTSW	9	8656730	missense	probably benign	0.42
R6284:Trpc6	UTSW	9	8643600	missense	possibly damaging	0.93
R6773:Trpc6	UTSW	9	8634057	missense	probably damaging	1.00
R6874:Trpc6	UTSW	9	8680438	missense	probably damaging	1.00
R7032:Trpc6	UTSW	9	8609950	missense	probably damaging	1.00
R7142:Trpc6	UTSW	9	8653016	nonsense	probably null
R7489:Trpc6	UTSW	9	8656544	missense	probably benign	0.00
R7631:Trpc6	UTSW	9	8626701	missense	probably benign
R7762:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91
R7872:Trpc6	UTSW	9	8609909	missense	probably damaging	1.00
R7895:Trpc6	UTSW	9	8655218	missense	probably damaging	1.00
R7911:Trpc6	UTSW	9	8656704	missense	probably benign
R8115:Trpc6	UTSW	9	8609981	missense	probably damaging	1.00
R8183:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91
R8435:Trpc6	UTSW	9	8610440	missense	probably damaging	1.00
R8929:Trpc6	UTSW	9	8643410	intron	probably benign
R9355:Trpc6	UTSW	9	8649472	missense	probably benign
R9511:Trpc6	UTSW	9	8680418	missense	probably benign	0.17
R9572:Trpc6	UTSW	9	8656621	missense	possibly damaging	0.93
Z1176:Trpc6	UTSW	9	8655213	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGCGAGGACCGTTCATGAAG -3'
(R):5'- CAAACCACGCATGAGAGGTTC -3'

Sequencing Primer
(F):5'- CATGAAGTTTGTAGCACACGC -3'
(R):5'- TGTAACTGGTAATAAGGCCACC -3'

Posted On

2015-12-21