Mutagenetix > Incidental Mutations

Incidental Mutation 'R4767:Myo5a'

366222

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

042408-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R4767 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75144076 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 317 (I317T)

Ref Sequence

ENSEMBL: ENSMUSP00000117493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: I317T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: I317T

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136731
AA Change: I317T

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: I317T

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142181

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: I317T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: I317T

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Meta Mutation Damage Score

0.8705

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	C	11: 46,138,977		probably null	Het
Aig1	T	C	10: 13,801,858	N130S	probably damaging	Het
Alx1	A	T	10: 103,025,186	Y160*	probably null	Het
Ap4e1	T	C	2: 127,060,438	I755T	probably benign	Het
Apoc3	C	A	9: 46,234,535	E21*	probably null	Het
Atp9b	G	T	18: 80,753,070	H919Q	probably damaging	Het
Cemip	T	G	7: 83,973,306	Y555S	probably damaging	Het
Cic	T	C	7: 25,271,600	V252A	possibly damaging	Het
Cracr2a	A	T	6: 127,611,507	N210Y	probably damaging	Het
Crocc2	G	A	1: 93,202,856	R953Q	possibly damaging	Het
Csnk1d	A	G	11: 120,969,128	S318P	probably benign	Het
Ddx21	A	G	10: 62,591,972	L384P	probably damaging	Het
Dnah5	C	T	15: 28,270,474	T974I	probably benign	Het
Duox1	A	G	2: 122,333,441	Y863C	possibly damaging	Het
Epg5	C	A	18: 78,023,283	P2133T	possibly damaging	Het
Ephb6	A	T	6: 41,614,185	Q92L	possibly damaging	Het
Ercc4	C	A	16: 13,122,095	A73D	probably damaging	Het
Eva1c	A	T	16: 90,904,347	Y290F	probably damaging	Het
Galnt5	T	A	2: 58,028,144	V798E	possibly damaging	Het
Haus4	T	C	14: 54,548,885	E149G	probably damaging	Het
Ighv1-13	A	G	12: 114,630,936	Y86C	unknown	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Lama3	T	C	18: 12,500,563	V1584A	probably benign	Het
Lamb1	A	G	12: 31,308,011	E1119G	probably damaging	Het
Lao1	T	C	4: 118,967,988	L335P	probably damaging	Het
Mindy4	A	G	6: 55,260,565	D375G	probably damaging	Het
Nhlrc2	G	A	19: 56,570,466	V128I	probably benign	Het
Nlrp2	C	T	7: 5,328,024	D458N	probably damaging	Het
Olfr107	T	A	17: 37,406,200	C217*	probably null	Het
Olfr1497	A	T	19: 13,795,045	C189S	probably damaging	Het
Olfr347	A	T	2: 36,734,323	M1L	probably benign	Het
Olfr76	G	T	19: 12,119,936	H247N	probably damaging	Het
Olfr938	T	C	9: 39,078,692	T18A	possibly damaging	Het
Parp8	T	C	13: 116,868,536	H663R	probably damaging	Het
Pax6	T	C	2: 105,695,360	S377P	probably benign	Het
Pi15	A	G	1: 17,602,766	D63G	probably benign	Het
Plaa	A	G	4: 94,586,258		probably benign	Het
Rbm5	C	A	9: 107,745,213	W546C	probably damaging	Het
Rnf123	C	A	9: 108,052,089	C1257F	probably damaging	Het
Rnf185	A	G	11: 3,432,551	S45P	possibly damaging	Het
Sh3bp1	T	C	15: 78,904,497	S241P	possibly damaging	Het
Slfn8	G	A	11: 83,003,197	A872V	possibly damaging	Het
Smoc1	G	A	12: 81,104,773		probably null	Het
Sox14	A	T	9: 99,875,633	W18R	probably damaging	Het
Spata31d1a	T	C	13: 59,701,155	E1053G	probably benign	Het
Syne1	T	A	10: 5,344,866	K1246*	probably null	Het
Tbrg4	A	C	11: 6,620,909	S188A	probably benign	Het
Thnsl2	A	T	6: 71,134,295	D196E	probably damaging	Het
Tmem266	C	T	9: 55,380,741	T34I	probably damaging	Het
Tmem59l	C	A	8: 70,486,098	R111L	probably benign	Het
Tpr	T	C	1: 150,430,529		probably benign	Het
Trpc6	T	C	9: 8,643,686	S491P	probably damaging	Het
Tspan10	A	T	11: 120,446,166	N254I	probably damaging	Het
Ubox5	A	T	2: 130,591,894	L511Q	probably damaging	Het
Vmn1r183	TATCCATC	TATC	7: 24,055,106		probably null	Het
Vmn2r4	C	T	3: 64,390,976	C577Y	probably damaging	Het
Vmn2r86	A	T	10: 130,455,737	M53K	probably benign	Het
Zfp948	T	A	17: 21,588,307	I587N	possibly damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	unclassified	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	synonymous	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7949:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- CCCACATTGCTAAACTGCCTAG -3'
(R):5'- TGCCTAGCATGTGCAGAGAC -3'

Sequencing Primer
(F):5'- GCTAAACTGCCTAGTATGTTACTGTC -3'
(R):5'- TAGCATGTGCAGAGACCCCTAG -3'

Posted On

2015-12-21