Mutagenetix > Incidental Mutations

Incidental Mutation 'R4767:Rnf123'

366225

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

042408-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R4767 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108052089 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 1257 (C1257F)

Ref Sequence

ENSEMBL: ENSMUSP00000136953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047746] [ENSMUST00000047947] [ENSMUST00000085060] [ENSMUST00000112295] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]

Predicted Effect

probably benign
Transcript: ENSMUST00000035214

SMART Domains

Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594

Domain	Start	End	E-Value	Type
low complexity region	114	129	N/A	INTRINSIC
Pfam:IPK	207	426	2.2e-67	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: C1263F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: C1263F

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000047947

SMART Domains

Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	2	234	8e-48	PFAM
Pfam:NTP_transf_3	3	202	6.6e-12	PFAM
Pfam:Hexapep	259	294	1.8e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085060

SMART Domains

Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	33	65	2.55e-2	SMART
LRR	65	83	6.97e1	SMART
LRR_TYP	84	107	1.56e-2	SMART
LRR	109	131	2.84e1	SMART
LRR	132	155	7.05e-1	SMART
LRR	156	176	3.98e1	SMART
LRR	182	206	5.56e0	SMART
Blast:LRRCT	219	274	8e-23	BLAST
IG	285	372	1.59e-6	SMART
transmembrane domain	383	405	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112295

SMART Domains

Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	2	235	2.1e-51	PFAM
Pfam:NTP_transf_3	3	199	1.1e-11	PFAM
Pfam:Hexapep	259	294	9.4e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137284

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150700

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159526

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: C1257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: C1257F

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160649

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162123

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: C1263F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: C1263F

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173683

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: C1257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: C1257F

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Meta Mutation Damage Score

0.9697

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	C	11: 46,138,977		probably null	Het
Aig1	T	C	10: 13,801,858	N130S	probably damaging	Het
Alx1	A	T	10: 103,025,186	Y160*	probably null	Het
Ap4e1	T	C	2: 127,060,438	I755T	probably benign	Het
Apoc3	C	A	9: 46,234,535	E21*	probably null	Het
Atp9b	G	T	18: 80,753,070	H919Q	probably damaging	Het
Cemip	T	G	7: 83,973,306	Y555S	probably damaging	Het
Cic	T	C	7: 25,271,600	V252A	possibly damaging	Het
Cracr2a	A	T	6: 127,611,507	N210Y	probably damaging	Het
Crocc2	G	A	1: 93,202,856	R953Q	possibly damaging	Het
Csnk1d	A	G	11: 120,969,128	S318P	probably benign	Het
Ddx21	A	G	10: 62,591,972	L384P	probably damaging	Het
Dnah5	C	T	15: 28,270,474	T974I	probably benign	Het
Duox1	A	G	2: 122,333,441	Y863C	possibly damaging	Het
Epg5	C	A	18: 78,023,283	P2133T	possibly damaging	Het
Ephb6	A	T	6: 41,614,185	Q92L	possibly damaging	Het
Ercc4	C	A	16: 13,122,095	A73D	probably damaging	Het
Eva1c	A	T	16: 90,904,347	Y290F	probably damaging	Het
Galnt5	T	A	2: 58,028,144	V798E	possibly damaging	Het
Haus4	T	C	14: 54,548,885	E149G	probably damaging	Het
Ighv1-13	A	G	12: 114,630,936	Y86C	unknown	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Lama3	T	C	18: 12,500,563	V1584A	probably benign	Het
Lamb1	A	G	12: 31,308,011	E1119G	probably damaging	Het
Lao1	T	C	4: 118,967,988	L335P	probably damaging	Het
Mindy4	A	G	6: 55,260,565	D375G	probably damaging	Het
Myo5a	T	C	9: 75,144,076	I317T	probably damaging	Het
Nhlrc2	G	A	19: 56,570,466	V128I	probably benign	Het
Nlrp2	C	T	7: 5,328,024	D458N	probably damaging	Het
Olfr107	T	A	17: 37,406,200	C217*	probably null	Het
Olfr1497	A	T	19: 13,795,045	C189S	probably damaging	Het
Olfr347	A	T	2: 36,734,323	M1L	probably benign	Het
Olfr76	G	T	19: 12,119,936	H247N	probably damaging	Het
Olfr938	T	C	9: 39,078,692	T18A	possibly damaging	Het
Parp8	T	C	13: 116,868,536	H663R	probably damaging	Het
Pax6	T	C	2: 105,695,360	S377P	probably benign	Het
Pi15	A	G	1: 17,602,766	D63G	probably benign	Het
Plaa	A	G	4: 94,586,258		probably benign	Het
Rbm5	C	A	9: 107,745,213	W546C	probably damaging	Het
Rnf185	A	G	11: 3,432,551	S45P	possibly damaging	Het
Sh3bp1	T	C	15: 78,904,497	S241P	possibly damaging	Het
Slfn8	G	A	11: 83,003,197	A872V	possibly damaging	Het
Smoc1	G	A	12: 81,104,773		probably null	Het
Sox14	A	T	9: 99,875,633	W18R	probably damaging	Het
Spata31d1a	T	C	13: 59,701,155	E1053G	probably benign	Het
Syne1	T	A	10: 5,344,866	K1246*	probably null	Het
Tbrg4	A	C	11: 6,620,909	S188A	probably benign	Het
Thnsl2	A	T	6: 71,134,295	D196E	probably damaging	Het
Tmem266	C	T	9: 55,380,741	T34I	probably damaging	Het
Tmem59l	C	A	8: 70,486,098	R111L	probably benign	Het
Tpr	T	C	1: 150,430,529		probably benign	Het
Trpc6	T	C	9: 8,643,686	S491P	probably damaging	Het
Tspan10	A	T	11: 120,446,166	N254I	probably damaging	Het
Ubox5	A	T	2: 130,591,894	L511Q	probably damaging	Het
Vmn1r183	TATCCATC	TATC	7: 24,055,106		probably null	Het
Vmn2r4	C	T	3: 64,390,976	C577Y	probably damaging	Het
Vmn2r86	A	T	10: 130,455,737	M53K	probably benign	Het
Zfp948	T	A	17: 21,588,307	I587N	possibly damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	unclassified	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	intron	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTGCAGAAGAAGCAGTCC -3'
(R):5'- ACAGATTATATCAGCGCTGAGG -3'

Sequencing Primer
(F):5'- CAGAAGAAGCAGTCCTTGTTGTTC -3'
(R):5'- TGGAACAGATGCTGGCTCAC -3'

Posted On

2015-12-21