Incidental Mutation 'R0410:Ap3s1'
ID36623
Institutional Source Beutler Lab
Gene Symbol Ap3s1
Ensembl Gene ENSMUSG00000024480
Gene Nameadaptor-related protein complex 3, sigma 1 subunit
Synonyms[s]3A
MMRRC Submission 038612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0410 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location46741876-46790826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46779212 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 100 (C100R)
Ref Sequence ENSEMBL: ENSMUSP00000153510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025357] [ENSMUST00000224622] [ENSMUST00000225415] [ENSMUST00000225520] [ENSMUST00000226108]
Predicted Effect probably benign
Transcript: ENSMUST00000025357
AA Change: C100R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000025357
Gene: ENSMUSG00000024480
AA Change: C100R

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 1.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224622
AA Change: C100R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000225415
Predicted Effect probably benign
Transcript: ENSMUST00000225520
AA Change: C100R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000226108
AA Change: C100R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the sigma subunit of the heterotetrameric adaptor protein complex AP-3 which is involved in the formation of specialized lysosome-related compartments such as melanosomes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on chromosomes 1, 8, 16, 17 and X. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,732 D170G probably benign Het
Actrt3 C T 3: 30,598,124 G274S probably benign Het
Adamts18 G T 8: 113,714,358 C889* probably null Het
AF529169 T G 9: 89,602,203 E380D probably damaging Het
Alkbh6 C T 7: 30,312,606 P104S probably damaging Het
Alms1 A T 6: 85,587,803 E53V unknown Het
Apbb2 G T 5: 66,451,806 A166E possibly damaging Het
Asph A G 4: 9,595,415 V174A probably damaging Het
Cacna2d2 T C 9: 107,524,620 L758P probably damaging Het
Cacng5 A G 11: 107,877,369 S271P possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Chn1 A T 2: 73,631,750 C236* probably null Het
Coro1b T C 19: 4,149,363 V7A probably damaging Het
Dhx16 A G 17: 35,890,967 Y962C probably damaging Het
Dixdc1 T C 9: 50,684,853 D152G probably damaging Het
Dmrt1 T C 19: 25,506,103 S84P probably damaging Het
Dnah10 A G 5: 124,755,735 D844G probably benign Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Efcab7 T C 4: 99,878,285 probably null Het
Fam83g A G 11: 61,703,392 D584G probably damaging Het
Fbxo7 T A 10: 86,029,238 probably null Het
Ffar1 T C 7: 30,860,630 T281A probably benign Het
Fntb T C 12: 76,888,052 V201A probably benign Het
Gart C A 16: 91,641,327 A101S probably damaging Het
Gbp9 T C 5: 105,085,073 T238A probably benign Het
Hectd4 T C 5: 121,286,266 L663S possibly damaging Het
Helz2 A T 2: 181,230,593 V2512E probably damaging Het
Hip1 A C 5: 135,458,155 L66R probably damaging Het
Iigp1 T A 18: 60,390,303 D164E probably benign Het
Kcnip3 A G 2: 127,460,066 S193P probably damaging Het
Klra9 T A 6: 130,188,744 T103S probably benign Het
Meis2 T C 2: 115,864,228 *471W probably null Het
Mrpl21 T C 19: 3,284,792 S45P possibly damaging Het
Mterf1b A G 5: 4,196,488 E43G probably benign Het
Mycbp2 G T 14: 103,135,133 S4092R probably damaging Het
Nfatc3 A T 8: 106,096,196 N538I probably damaging Het
Nphp4 T C 4: 152,557,046 C1095R probably benign Het
Npm2 T A 14: 70,652,553 T13S probably benign Het
Olfr24 C A 9: 18,754,841 V265F probably damaging Het
Olfr872 T A 9: 20,260,501 F220L probably benign Het
Plcg2 A T 8: 117,615,373 I1158F probably damaging Het
Popdc3 T C 10: 45,317,733 V210A possibly damaging Het
Postn T C 3: 54,385,277 L755S possibly damaging Het
Prdx6b T C 2: 80,293,029 F61L probably damaging Het
Rars C T 11: 35,826,020 R223H probably damaging Het
Robo1 G A 16: 72,971,984 G479D possibly damaging Het
Scaf4 A G 16: 90,260,170 Y98H unknown Het
Scn4a A G 11: 106,323,949 I1274T probably damaging Het
Senp2 G T 16: 22,009,694 R18L probably damaging Het
Six5 T A 7: 19,096,456 V336D probably damaging Het
Slc31a2 G A 4: 62,292,653 E8K probably benign Het
Slc4a7 A T 14: 14,738,299 T184S probably damaging Het
Slco2a1 T A 9: 103,073,314 probably null Het
Smr3a T G 5: 88,008,211 probably benign Het
Sqor T C 2: 122,787,522 V100A probably benign Het
Srarp T C 4: 141,433,148 N125D possibly damaging Het
Stam T C 2: 14,138,991 V364A probably benign Het
Tgm5 T C 2: 121,077,558 I46V possibly damaging Het
Tie1 A T 4: 118,480,569 V443E probably damaging Het
Tipin T C 9: 64,288,115 M1T probably null Het
Tnc T C 4: 64,007,694 T950A probably benign Het
Tns3 T C 11: 8,435,852 D1382G probably benign Het
Tor1aip1 A G 1: 156,035,940 V99A possibly damaging Het
Trim16 C T 11: 62,820,471 probably benign Het
Ttn G T 2: 76,788,357 N14448K possibly damaging Het
Ttn C T 2: 76,886,860 probably benign Het
Vmn1r23 A G 6: 57,926,190 I201T probably benign Het
Vmn2r13 T A 5: 109,173,813 K339N probably benign Het
Yap1 A G 9: 8,001,467 Y173H probably damaging Het
Zcchc11 A G 4: 108,486,555 R255G probably benign Het
Other mutations in Ap3s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Ap3s1 UTSW 18 46758039 missense probably damaging 1.00
R2102:Ap3s1 UTSW 18 46754402 missense possibly damaging 0.88
R4234:Ap3s1 UTSW 18 46779200 missense probably benign 0.28
R4500:Ap3s1 UTSW 18 46790000 missense possibly damaging 0.47
R4894:Ap3s1 UTSW 18 46758116 critical splice donor site probably null
R5081:Ap3s1 UTSW 18 46754430 missense probably benign 0.01
R6063:Ap3s1 UTSW 18 46754438 missense probably benign 0.02
R6209:Ap3s1 UTSW 18 46779251 missense probably benign 0.00
R6250:Ap3s1 UTSW 18 46754447 missense probably damaging 1.00
R6401:Ap3s1 UTSW 18 46758007 missense probably benign 0.00
R6575:Ap3s1 UTSW 18 46754381 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCAAACCCTTTCCTGAGGAGGC -3'
(R):5'- TAGGAACTCTCCCAGGGCATACAC -3'

Sequencing Primer
(F):5'- GTCAGAAGTTTGTCTGATATACCAC -3'
(R):5'- TACTTCAAGCACAGTGGCCTG -3'
Posted On2013-05-09