Mutagenetix > Incidental Mutation

Incidental Mutation 'R4767:Slfn8'

366234

Institutional Source

Beutler Lab

Gene Symbol

Slfn8

Ensembl Gene

ENSMUSG00000035208

Gene Name

schlafen 8

Synonyms

MMRRC Submission

042408-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R4767 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83002158-83020810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83003197 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 872 (A872V)

Ref Sequence

ENSEMBL: ENSMUSP00000090513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]

AlphaFold

B1ARD8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038141
AA Change: A872V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: A872V

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	1.6e-18	PFAM
Pfam:DUF2075	592	766	5.8e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092838
AA Change: A872V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: A872V

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	205	341	1.4e-17	PFAM
Pfam:DUF2075	592	767	2.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108152

SMART Domains

Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	4.1e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130822

SMART Domains

Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	3.7e-19	PFAM
SCOP:d1ly1a_	593	625	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131883

SMART Domains

Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	27	163	1.8e-15	PFAM
SCOP:d1ly1a_	370	402	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215239

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

95% (62/65)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	C	11: 46,138,977		probably null	Het
Aig1	T	C	10: 13,801,858	N130S	probably damaging	Het
Alx1	A	T	10: 103,025,186	Y160*	probably null	Het
Ap4e1	T	C	2: 127,060,438	I755T	probably benign	Het
Apoc3	C	A	9: 46,234,535	E21*	probably null	Het
Atp9b	G	T	18: 80,753,070	H919Q	probably damaging	Het
Cemip	T	G	7: 83,973,306	Y555S	probably damaging	Het
Cic	T	C	7: 25,271,600	V252A	possibly damaging	Het
Cracr2a	A	T	6: 127,611,507	N210Y	probably damaging	Het
Crocc2	G	A	1: 93,202,856	R953Q	possibly damaging	Het
Csnk1d	A	G	11: 120,969,128	S318P	probably benign	Het
Ddx21	A	G	10: 62,591,972	L384P	probably damaging	Het
Dnah5	C	T	15: 28,270,474	T974I	probably benign	Het
Duox1	A	G	2: 122,333,441	Y863C	possibly damaging	Het
Epg5	C	A	18: 78,023,283	P2133T	possibly damaging	Het
Ephb6	A	T	6: 41,614,185	Q92L	possibly damaging	Het
Ercc4	C	A	16: 13,122,095	A73D	probably damaging	Het
Eva1c	A	T	16: 90,904,347	Y290F	probably damaging	Het
Galnt5	T	A	2: 58,028,144	V798E	possibly damaging	Het
Haus4	T	C	14: 54,548,885	E149G	probably damaging	Het
Ighv1-13	A	G	12: 114,630,936	Y86C	unknown	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Lama3	T	C	18: 12,500,563	V1584A	probably benign	Het
Lamb1	A	G	12: 31,308,011	E1119G	probably damaging	Het
Lao1	T	C	4: 118,967,988	L335P	probably damaging	Het
Mindy4	A	G	6: 55,260,565	D375G	probably damaging	Het
Myo5a	T	C	9: 75,144,076	I317T	probably damaging	Het
Nhlrc2	G	A	19: 56,570,466	V128I	probably benign	Het
Nlrp2	C	T	7: 5,328,024	D458N	probably damaging	Het
Olfr107	T	A	17: 37,406,200	C217*	probably null	Het
Olfr1497	A	T	19: 13,795,045	C189S	probably damaging	Het
Olfr347	A	T	2: 36,734,323	M1L	probably benign	Het
Olfr76	G	T	19: 12,119,936	H247N	probably damaging	Het
Olfr938	T	C	9: 39,078,692	T18A	possibly damaging	Het
Parp8	T	C	13: 116,868,536	H663R	probably damaging	Het
Pax6	T	C	2: 105,695,360	S377P	probably benign	Het
Pi15	A	G	1: 17,602,766	D63G	probably benign	Het
Plaa	A	G	4: 94,586,258		probably benign	Het
Rbm5	C	A	9: 107,745,213	W546C	probably damaging	Het
Rnf123	C	A	9: 108,052,089	C1257F	probably damaging	Het
Rnf185	A	G	11: 3,432,551	S45P	possibly damaging	Het
Sh3bp1	T	C	15: 78,904,497	S241P	possibly damaging	Het
Smoc1	G	A	12: 81,104,773		probably null	Het
Sox14	A	T	9: 99,875,633	W18R	probably damaging	Het
Spata31d1a	T	C	13: 59,701,155	E1053G	probably benign	Het
Syne1	T	A	10: 5,344,866	K1246*	probably null	Het
Tbrg4	A	C	11: 6,620,909	S188A	probably benign	Het
Thnsl2	A	T	6: 71,134,295	D196E	probably damaging	Het
Tmem266	C	T	9: 55,380,741	T34I	probably damaging	Het
Tmem59l	C	A	8: 70,486,098	R111L	probably benign	Het
Tpr	T	C	1: 150,430,529		probably benign	Het
Trpc6	T	C	9: 8,643,686	S491P	probably damaging	Het
Tspan10	A	T	11: 120,446,166	N254I	probably damaging	Het
Ubox5	A	T	2: 130,591,894	L511Q	probably damaging	Het
Vmn1r183	TATCCATC	TATC	7: 24,055,106		probably null	Het
Vmn2r4	C	T	3: 64,390,976	C577Y	probably damaging	Het
Vmn2r86	A	T	10: 130,455,737	M53K	probably benign	Het
Zfp948	T	A	17: 21,588,307	I587N	possibly damaging	Het

Other mutations in Slfn8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Slfn8	APN	11	83013484	missense	possibly damaging	0.75
IGL01418:Slfn8	APN	11	83004636	missense	probably damaging	1.00
IGL01620:Slfn8	APN	11	83004233	nonsense	probably null
IGL01875:Slfn8	APN	11	83004079	missense	probably benign	0.30
IGL01896:Slfn8	APN	11	83003696	missense	probably damaging	1.00
IGL01929:Slfn8	APN	11	83003405	nonsense	probably null
IGL02111:Slfn8	APN	11	83004498	missense	probably damaging	1.00
IGL02136:Slfn8	APN	11	83003465	nonsense	probably null
IGL02165:Slfn8	APN	11	83017196	missense	probably benign	0.00
IGL02645:Slfn8	APN	11	83003554	missense	possibly damaging	0.82
IGL02682:Slfn8	APN	11	83003691	missense	probably damaging	1.00
IGL02689:Slfn8	APN	11	83017108	missense	probably damaging	1.00
IGL02948:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03037:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03185:Slfn8	APN	11	83017507	missense	probably benign	0.01
IGL03243:Slfn8	APN	11	83003707	missense	probably damaging	1.00
IGL03286:Slfn8	APN	11	83013468	missense	probably damaging	0.99
seven_dwarfs	UTSW	11	83003334	missense	probably benign	0.09
vanwinkle	UTSW	11	83017393	missense	probably damaging	1.00
R0295:Slfn8	UTSW	11	83003343	nonsense	probably null
R0368:Slfn8	UTSW	11	83017132	missense	probably damaging	1.00
R0382:Slfn8	UTSW	11	83004556	missense	probably damaging	1.00
R0655:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R0894:Slfn8	UTSW	11	83003581	missense	probably benign	0.07
R1006:Slfn8	UTSW	11	83003511	missense	possibly damaging	0.69
R1181:Slfn8	UTSW	11	83016745	missense	probably benign	0.19
R1187:Slfn8	UTSW	11	83003488	missense	probably damaging	1.00
R1501:Slfn8	UTSW	11	83003180	missense	probably damaging	0.99
R1646:Slfn8	UTSW	11	83016886	missense	probably damaging	1.00
R1909:Slfn8	UTSW	11	83003621	nonsense	probably null
R2005:Slfn8	UTSW	11	83004150	missense	probably damaging	1.00
R2363:Slfn8	UTSW	11	83004094	missense	probably damaging	1.00
R3780:Slfn8	UTSW	11	83017454	missense	probably benign	0.13
R3890:Slfn8	UTSW	11	83004444	missense	possibly damaging	0.68
R3917:Slfn8	UTSW	11	83016993	nonsense	probably null
R4559:Slfn8	UTSW	11	83004744	missense	probably damaging	1.00
R4684:Slfn8	UTSW	11	83017506	missense	probably benign	0.10
R4773:Slfn8	UTSW	11	83017393	missense	probably damaging	1.00
R4859:Slfn8	UTSW	11	83017714	start codon destroyed	probably null	0.99
R4916:Slfn8	UTSW	11	83016878	missense	probably damaging	1.00
R4939:Slfn8	UTSW	11	83003285	missense	probably benign	0.01
R5107:Slfn8	UTSW	11	83017150	missense	probably damaging	0.99
R5130:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R5165:Slfn8	UTSW	11	83017127	missense	probably damaging	0.99
R5238:Slfn8	UTSW	11	83013388	missense	probably damaging	0.96
R5282:Slfn8	UTSW	11	83017724	critical splice acceptor site	probably null
R5311:Slfn8	UTSW	11	83004084	missense	probably damaging	1.00
R5499:Slfn8	UTSW	11	83004216	missense	probably damaging	0.99
R5617:Slfn8	UTSW	11	83004721	missense	probably benign	0.01
R5782:Slfn8	UTSW	11	83017041	missense	probably damaging	0.98
R5823:Slfn8	UTSW	11	83016736	missense	probably benign	0.01
R5886:Slfn8	UTSW	11	83003334	missense	probably benign	0.09
R5933:Slfn8	UTSW	11	83003335	missense	probably benign	0.00
R6151:Slfn8	UTSW	11	83017321	missense	probably damaging	1.00
R6163:Slfn8	UTSW	11	83003864	makesense	probably null
R6191:Slfn8	UTSW	11	83016800	missense	possibly damaging	0.72
R6419:Slfn8	UTSW	11	83004055	splice site	probably null
R6925:Slfn8	UTSW	11	83013417	nonsense	probably null
R7065:Slfn8	UTSW	11	83016968	missense	probably benign	0.01
R7380:Slfn8	UTSW	11	83003740	missense	not run
R7414:Slfn8	UTSW	11	83016792	nonsense	probably null
R7819:Slfn8	UTSW	11	83004255	missense	probably damaging	1.00
R8425:Slfn8	UTSW	11	83004615	missense	possibly damaging	0.80
R8517:Slfn8	UTSW	11	83004142	missense	possibly damaging	0.68
R8804:Slfn8	UTSW	11	83016813	missense	possibly damaging	0.94
R8814:Slfn8	UTSW	11	83016679	missense	possibly damaging	0.95
R9069:Slfn8	UTSW	11	83017076	missense	probably damaging	1.00
R9233:Slfn8	UTSW	11	83003596	missense	probably damaging	1.00
R9457:Slfn8	UTSW	11	83017706	missense	probably benign
R9678:Slfn8	UTSW	11	83016897	missense	probably damaging	1.00
R9708:Slfn8	UTSW	11	83003441	missense	probably benign	0.00
R9764:Slfn8	UTSW	11	83017012	missense	probably damaging	1.00
X0021:Slfn8	UTSW	11	83016928	missense	possibly damaging	0.69
Z1177:Slfn8	UTSW	11	83003533	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CTGAAGGACCTCGACTTGATTTAAC -3'
(R):5'- GCGTAAAGGCTATTCTCTCCAAG -3'

Sequencing Primer
(F):5'- ACTTTCTCATCATCAGGGATTGAACC -3'
(R):5'- GGCTATTCTCTCCAAGATATTGCAG -3'

Posted On

2015-12-21