Mutagenetix > Incidental Mutation

Incidental Mutation 'R4767:Lamb1'

366237

Institutional Source

Beutler Lab

Gene Symbol

Lamb1

Ensembl Gene

ENSMUSG00000002900

Gene Name

laminin B1

Synonyms

C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik

MMRRC Submission

042408-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4767 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

31265234-31329644 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31308011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1119 (E1119G)

Ref Sequence

ENSEMBL: ENSMUSP00000132778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]

AlphaFold

P02469

PDB Structure

Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002979
AA Change: E1167G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: E1167G

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART
EGF_Lam	558	602	3.4e-8	SMART
EGF_Lam	821	866	4.99e-15	SMART
EGF_Lam	869	912	2.38e-12	SMART
EGF_Lam	915	962	2.4e-8	SMART
EGF_Lam	965	1021	1.41e-5	SMART
EGF_Lam	1024	1073	4.81e-8	SMART
EGF_Lam	1076	1129	3.81e-11	SMART
EGF_Lam	1132	1177	5.61e-9	SMART
EGF_Lam	1180	1224	2.89e-11	SMART
coiled coil region	1329	1360	N/A	INTRINSIC
low complexity region	1468	1480	N/A	INTRINSIC
coiled coil region	1497	1551	N/A	INTRINSIC
coiled coil region	1600	1826	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169088
AA Change: E1119G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: E1119G

Domain	Start	End	E-Value	Type
LamNT	29	269	3.24e-96	SMART
EGF_Lam	271	332	1.34e-6	SMART
EGF_Lam	335	395	1.33e-10	SMART
EGF_Lam	398	455	2.89e-11	SMART
EGF_Lam	458	507	2.89e-11	SMART
EGF_Lam	510	554	3.4e-8	SMART
EGF_Lam	773	818	4.99e-15	SMART
EGF_Lam	821	864	2.38e-12	SMART
EGF_Lam	867	914	2.4e-8	SMART
EGF_Lam	917	973	1.41e-5	SMART
EGF_Lam	976	1025	4.81e-8	SMART
EGF_Lam	1028	1081	3.81e-11	SMART
EGF_Lam	1084	1129	5.61e-9	SMART
EGF_Lam	1132	1176	2.89e-11	SMART
coiled coil region	1281	1312	N/A	INTRINSIC
low complexity region	1420	1432	N/A	INTRINSIC
coiled coil region	1449	1503	N/A	INTRINSIC
coiled coil region	1552	1778	N/A	INTRINSIC

Meta Mutation Damage Score

0.2914

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	C	11: 46,138,977		probably null	Het
Aig1	T	C	10: 13,801,858	N130S	probably damaging	Het
Alx1	A	T	10: 103,025,186	Y160*	probably null	Het
Ap4e1	T	C	2: 127,060,438	I755T	probably benign	Het
Apoc3	C	A	9: 46,234,535	E21*	probably null	Het
Atp9b	G	T	18: 80,753,070	H919Q	probably damaging	Het
Cemip	T	G	7: 83,973,306	Y555S	probably damaging	Het
Cic	T	C	7: 25,271,600	V252A	possibly damaging	Het
Cracr2a	A	T	6: 127,611,507	N210Y	probably damaging	Het
Crocc2	G	A	1: 93,202,856	R953Q	possibly damaging	Het
Csnk1d	A	G	11: 120,969,128	S318P	probably benign	Het
Ddx21	A	G	10: 62,591,972	L384P	probably damaging	Het
Dnah5	C	T	15: 28,270,474	T974I	probably benign	Het
Duox1	A	G	2: 122,333,441	Y863C	possibly damaging	Het
Epg5	C	A	18: 78,023,283	P2133T	possibly damaging	Het
Ephb6	A	T	6: 41,614,185	Q92L	possibly damaging	Het
Ercc4	C	A	16: 13,122,095	A73D	probably damaging	Het
Eva1c	A	T	16: 90,904,347	Y290F	probably damaging	Het
Galnt5	T	A	2: 58,028,144	V798E	possibly damaging	Het
Haus4	T	C	14: 54,548,885	E149G	probably damaging	Het
Ighv1-13	A	G	12: 114,630,936	Y86C	unknown	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Lama3	T	C	18: 12,500,563	V1584A	probably benign	Het
Lao1	T	C	4: 118,967,988	L335P	probably damaging	Het
Mindy4	A	G	6: 55,260,565	D375G	probably damaging	Het
Myo5a	T	C	9: 75,144,076	I317T	probably damaging	Het
Nhlrc2	G	A	19: 56,570,466	V128I	probably benign	Het
Nlrp2	C	T	7: 5,328,024	D458N	probably damaging	Het
Olfr107	T	A	17: 37,406,200	C217*	probably null	Het
Olfr1497	A	T	19: 13,795,045	C189S	probably damaging	Het
Olfr347	A	T	2: 36,734,323	M1L	probably benign	Het
Olfr76	G	T	19: 12,119,936	H247N	probably damaging	Het
Olfr938	T	C	9: 39,078,692	T18A	possibly damaging	Het
Parp8	T	C	13: 116,868,536	H663R	probably damaging	Het
Pax6	T	C	2: 105,695,360	S377P	probably benign	Het
Pi15	A	G	1: 17,602,766	D63G	probably benign	Het
Plaa	A	G	4: 94,586,258		probably benign	Het
Rbm5	C	A	9: 107,745,213	W546C	probably damaging	Het
Rnf123	C	A	9: 108,052,089	C1257F	probably damaging	Het
Rnf185	A	G	11: 3,432,551	S45P	possibly damaging	Het
Sh3bp1	T	C	15: 78,904,497	S241P	possibly damaging	Het
Slfn8	G	A	11: 83,003,197	A872V	possibly damaging	Het
Smoc1	G	A	12: 81,104,773		probably null	Het
Sox14	A	T	9: 99,875,633	W18R	probably damaging	Het
Spata31d1a	T	C	13: 59,701,155	E1053G	probably benign	Het
Syne1	T	A	10: 5,344,866	K1246*	probably null	Het
Tbrg4	A	C	11: 6,620,909	S188A	probably benign	Het
Thnsl2	A	T	6: 71,134,295	D196E	probably damaging	Het
Tmem266	C	T	9: 55,380,741	T34I	probably damaging	Het
Tmem59l	C	A	8: 70,486,098	R111L	probably benign	Het
Tpr	T	C	1: 150,430,529		probably benign	Het
Trpc6	T	C	9: 8,643,686	S491P	probably damaging	Het
Tspan10	A	T	11: 120,446,166	N254I	probably damaging	Het
Ubox5	A	T	2: 130,591,894	L511Q	probably damaging	Het
Vmn1r183	TATCCATC	TATC	7: 24,055,106		probably null	Het
Vmn2r4	C	T	3: 64,390,976	C577Y	probably damaging	Het
Vmn2r86	A	T	10: 130,455,737	M53K	probably benign	Het
Zfp948	T	A	17: 21,588,307	I587N	possibly damaging	Het

Other mutations in Lamb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Lamb1	APN	12	31298826	missense	possibly damaging	0.74
IGL00939:Lamb1	APN	12	31302927	missense	probably damaging	1.00
IGL01017:Lamb1	APN	12	31301064	missense	possibly damaging	0.89
IGL01384:Lamb1	APN	12	31320931	missense	probably benign	0.09
IGL01470:Lamb1	APN	12	31300262	missense	possibly damaging	0.55
IGL01554:Lamb1	APN	12	31306977	missense	probably damaging	1.00
IGL02207:Lamb1	APN	12	31329435	missense	probably damaging	1.00
IGL02271:Lamb1	APN	12	31300251	missense	probably damaging	1.00
IGL02272:Lamb1	APN	12	31305769	missense	probably benign	0.00
IGL02365:Lamb1	APN	12	31318345	missense	probably damaging	1.00
IGL02471:Lamb1	APN	12	31320908	missense	probably damaging	1.00
IGL02704:Lamb1	APN	12	31318467	missense	probably benign	0.05
IGL03132:Lamb1	APN	12	31300334	splice site	probably null
IGL03161:Lamb1	APN	12	31326256	missense	probably benign	0.41
IGL03169:Lamb1	APN	12	31323646	missense	probably damaging	1.00
Crush	UTSW	12	31287424	missense	probably damaging	1.00
Deflationary	UTSW	12	31321075	missense	probably null	0.63
E0374:Lamb1	UTSW	12	31287930	missense	probably damaging	1.00
P0043:Lamb1	UTSW	12	31278621	missense	probably damaging	1.00
R0031:Lamb1	UTSW	12	31301156	missense	probably benign	0.04
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0285:Lamb1	UTSW	12	31326645	nonsense	probably null
R0456:Lamb1	UTSW	12	31304730	missense	probably damaging	1.00
R0477:Lamb1	UTSW	12	31326269	missense	possibly damaging	0.47
R0480:Lamb1	UTSW	12	31282721	missense	possibly damaging	0.79
R0544:Lamb1	UTSW	12	31282695	missense	probably damaging	1.00
R0565:Lamb1	UTSW	12	31298915	missense	probably benign	0.02
R1500:Lamb1	UTSW	12	31298949	missense	possibly damaging	0.82
R1624:Lamb1	UTSW	12	31278652	critical splice donor site	probably null
R1772:Lamb1	UTSW	12	31278525	missense	probably damaging	1.00
R1836:Lamb1	UTSW	12	31301094	missense	probably benign	0.00
R1853:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1854:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1903:Lamb1	UTSW	12	31329210	missense	probably damaging	1.00
R2091:Lamb1	UTSW	12	31287429	missense	probably damaging	0.98
R2186:Lamb1	UTSW	12	31318467	nonsense	probably null
R2268:Lamb1	UTSW	12	31327645	missense	probably damaging	1.00
R2567:Lamb1	UTSW	12	31269055	critical splice acceptor site	probably null
R2698:Lamb1	UTSW	12	31298883	missense	probably benign	0.10
R3121:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3405:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3406:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3608:Lamb1	UTSW	12	31287910	missense	probably damaging	1.00
R3725:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3726:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3949:Lamb1	UTSW	12	31282649	missense	probably damaging	1.00
R4308:Lamb1	UTSW	12	31329255	missense	probably damaging	1.00
R4600:Lamb1	UTSW	12	31323529	missense	probably benign	0.00
R4604:Lamb1	UTSW	12	31278776	missense	probably damaging	1.00
R4701:Lamb1	UTSW	12	31266848	nonsense	probably null
R4710:Lamb1	UTSW	12	31282583	missense	probably benign	0.02
R4809:Lamb1	UTSW	12	31278526	missense	probably damaging	1.00
R4828:Lamb1	UTSW	12	31298930	missense	probably benign
R4842:Lamb1	UTSW	12	31287433	missense	probably damaging	1.00
R4864:Lamb1	UTSW	12	31321006	missense	probably benign	0.01
R4909:Lamb1	UTSW	12	31288281	missense	probably damaging	1.00
R4989:Lamb1	UTSW	12	31326678	missense	probably damaging	1.00
R5444:Lamb1	UTSW	12	31298909	missense	possibly damaging	0.47
R5736:Lamb1	UTSW	12	31302665	nonsense	probably null
R5766:Lamb1	UTSW	12	31299931	missense	probably damaging	1.00
R5825:Lamb1	UTSW	12	31318614	missense	probably benign
R5840:Lamb1	UTSW	12	31266756	missense	probably damaging	1.00
R5867:Lamb1	UTSW	12	31298955	missense	possibly damaging	0.82
R5887:Lamb1	UTSW	12	31266864	nonsense	probably null
R5984:Lamb1	UTSW	12	31327774	missense	possibly damaging	0.76
R6313:Lamb1	UTSW	12	31269147	missense	probably damaging	1.00
R6359:Lamb1	UTSW	12	31282716	missense	probably damaging	0.97
R6505:Lamb1	UTSW	12	31323462	missense	possibly damaging	0.63
R7127:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7202:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7271:Lamb1	UTSW	12	31287424	missense	probably damaging	1.00
R7290:Lamb1	UTSW	12	31265596	missense	probably benign	0.04
R7486:Lamb1	UTSW	12	31287442	missense	probably benign	0.00
R7496:Lamb1	UTSW	12	31300021	missense	probably benign	0.31
R7591:Lamb1	UTSW	12	31326648	missense	probably damaging	1.00
R7722:Lamb1	UTSW	12	31323571	missense	probably damaging	0.99
R7985:Lamb1	UTSW	12	31300215	missense	possibly damaging	0.93
R8058:Lamb1	UTSW	12	31303047	missense	probably benign	0.16
R8353:Lamb1	UTSW	12	31306999	missense	probably damaging	1.00
R8506:Lamb1	UTSW	12	31329361	missense	probably damaging	1.00
R8846:Lamb1	UTSW	12	31329389	missense	possibly damaging	0.75
R8888:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R8895:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R9312:Lamb1	UTSW	12	31318353	missense	probably damaging	1.00
R9340:Lamb1	UTSW	12	31324224	missense	probably benign
R9340:Lamb1	UTSW	12	31324225	missense	probably benign
R9371:Lamb1	UTSW	12	31298864	missense	probably damaging	0.98
R9417:Lamb1	UTSW	12	31287984	missense	probably damaging	1.00
R9562:Lamb1	UTSW	12	31272493	missense	probably damaging	1.00
R9626:Lamb1	UTSW	12	31304670	missense	probably benign
R9641:Lamb1	UTSW	12	31287458	missense	probably damaging	0.97
X0054:Lamb1	UTSW	12	31287434	missense	probably damaging	1.00
X0064:Lamb1	UTSW	12	31303042	missense	probably benign	0.35
Z1176:Lamb1	UTSW	12	31327702	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- GCCCCTTGTAAGAGAACAGC -3'
(R):5'- GCTAGATTAAAAGTTCTGGCCACAC -3'

Sequencing Primer
(F):5'- CCCCTTGTAAGAGAACAGCTAGGAG -3'
(R):5'- AAGTTCTGGCCACACCCCTC -3'

Posted On

2015-12-21