Incidental Mutation 'R4767:Sh3bp1'
ID 366243
Institutional Source Beutler Lab
Gene Symbol Sh3bp1
Ensembl Gene ENSMUSG00000022436
Gene Name SH3-domain binding protein 1
Synonyms 3BP-1
MMRRC Submission 042408-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R4767 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 78783994-78796247 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78788697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 241 (S241P)
Ref Sequence ENSEMBL: ENSMUSP00000001226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001226] [ENSMUST00000061239] [ENSMUST00000109698] [ENSMUST00000132047] [ENSMUST00000134703] [ENSMUST00000148893] [ENSMUST00000151146]
AlphaFold P55194
Predicted Effect possibly damaging
Transcript: ENSMUST00000001226
AA Change: S241P

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001226
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 7e-37 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
low complexity region 558 593 N/A INTRINSIC
low complexity region 604 633 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061239
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052181
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109698
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105320
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132047
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138598
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 5.4e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134703
AA Change: S177P

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000148893
SMART Domains Protein: ENSMUSP00000117839
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Blast:BAR 2 55 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151146
SMART Domains Protein: ENSMUSP00000138780
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 143 9e-22 PFAM
low complexity region 160 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229803
Meta Mutation Damage Score 0.7038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,029,804 (GRCm39) probably null Het
Aig1 T C 10: 13,677,602 (GRCm39) N130S probably damaging Het
Alx1 A T 10: 102,861,047 (GRCm39) Y160* probably null Het
Ap4e1 T C 2: 126,902,358 (GRCm39) I755T probably benign Het
Apoc3 C A 9: 46,145,833 (GRCm39) E21* probably null Het
Atp9b G T 18: 80,796,285 (GRCm39) H919Q probably damaging Het
Cemip T G 7: 83,622,514 (GRCm39) Y555S probably damaging Het
Cic T C 7: 24,971,025 (GRCm39) V252A possibly damaging Het
Cracr2a A T 6: 127,588,470 (GRCm39) N210Y probably damaging Het
Crocc2 G A 1: 93,130,578 (GRCm39) R953Q possibly damaging Het
Csnk1d A G 11: 120,859,954 (GRCm39) S318P probably benign Het
Ddx21 A G 10: 62,427,751 (GRCm39) L384P probably damaging Het
Dnah5 C T 15: 28,270,620 (GRCm39) T974I probably benign Het
Duox1 A G 2: 122,163,922 (GRCm39) Y863C possibly damaging Het
Epg5 C A 18: 78,066,498 (GRCm39) P2133T possibly damaging Het
Ephb6 A T 6: 41,591,119 (GRCm39) Q92L possibly damaging Het
Ercc4 C A 16: 12,939,959 (GRCm39) A73D probably damaging Het
Eva1c A T 16: 90,701,235 (GRCm39) Y290F probably damaging Het
Galnt5 T A 2: 57,918,156 (GRCm39) V798E possibly damaging Het
Haus4 T C 14: 54,786,342 (GRCm39) E149G probably damaging Het
Ighv1-13 A G 12: 114,594,556 (GRCm39) Y86C unknown Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Lama3 T C 18: 12,633,620 (GRCm39) V1584A probably benign Het
Lamb1 A G 12: 31,358,010 (GRCm39) E1119G probably damaging Het
Lao1 T C 4: 118,825,185 (GRCm39) L335P probably damaging Het
Mindy4 A G 6: 55,237,550 (GRCm39) D375G probably damaging Het
Myo5a T C 9: 75,051,358 (GRCm39) I317T probably damaging Het
Nhlrc2 G A 19: 56,558,898 (GRCm39) V128I probably benign Het
Nlrp2 C T 7: 5,331,023 (GRCm39) D458N probably damaging Het
Or1j18 A T 2: 36,624,335 (GRCm39) M1L probably benign Het
Or1o1 T A 17: 37,717,091 (GRCm39) C217* probably null Het
Or5a1 G T 19: 12,097,300 (GRCm39) H247N probably damaging Het
Or8g24 T C 9: 38,989,988 (GRCm39) T18A possibly damaging Het
Or9q2 A T 19: 13,772,409 (GRCm39) C189S probably damaging Het
Parp8 T C 13: 117,005,072 (GRCm39) H663R probably damaging Het
Pax6 T C 2: 105,525,705 (GRCm39) S377P probably benign Het
Pi15 A G 1: 17,672,990 (GRCm39) D63G probably benign Het
Plaa A G 4: 94,474,495 (GRCm39) probably benign Het
Rbm5 C A 9: 107,622,412 (GRCm39) W546C probably damaging Het
Rnf123 C A 9: 107,929,288 (GRCm39) C1257F probably damaging Het
Rnf185 A G 11: 3,382,551 (GRCm39) S45P possibly damaging Het
Slfn8 G A 11: 82,894,023 (GRCm39) A872V possibly damaging Het
Smoc1 G A 12: 81,151,547 (GRCm39) probably null Het
Sox14 A T 9: 99,757,686 (GRCm39) W18R probably damaging Het
Spata31d1a T C 13: 59,848,969 (GRCm39) E1053G probably benign Het
Syne1 T A 10: 5,294,866 (GRCm39) K1246* probably null Het
Tbrg4 A C 11: 6,570,909 (GRCm39) S188A probably benign Het
Thnsl2 A T 6: 71,111,279 (GRCm39) D196E probably damaging Het
Tmem266 C T 9: 55,288,025 (GRCm39) T34I probably damaging Het
Tmem59l C A 8: 70,938,748 (GRCm39) R111L probably benign Het
Tpr T C 1: 150,306,280 (GRCm39) probably benign Het
Trpc6 T C 9: 8,643,687 (GRCm39) S491P probably damaging Het
Tspan10 A T 11: 120,336,992 (GRCm39) N254I probably damaging Het
Ubox5 A T 2: 130,433,814 (GRCm39) L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 23,754,531 (GRCm39) probably null Het
Vmn2r4 C T 3: 64,298,397 (GRCm39) C577Y probably damaging Het
Vmn2r86 A T 10: 130,291,606 (GRCm39) M53K probably benign Het
Zfp948 T A 17: 21,808,569 (GRCm39) I587N possibly damaging Het
Other mutations in Sh3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Sh3bp1 APN 15 78,789,314 (GRCm39) missense possibly damaging 0.58
IGL01879:Sh3bp1 APN 15 78,792,192 (GRCm39) missense probably damaging 1.00
IGL02112:Sh3bp1 APN 15 78,790,084 (GRCm39) critical splice donor site probably null
IGL02216:Sh3bp1 APN 15 78,789,364 (GRCm39) missense probably benign 0.07
IGL02385:Sh3bp1 APN 15 78,790,088 (GRCm39) splice site probably benign
IGL02417:Sh3bp1 APN 15 78,785,699 (GRCm39) missense probably damaging 1.00
IGL02551:Sh3bp1 APN 15 78,788,538 (GRCm39) missense probably benign 0.01
PIT1430001:Sh3bp1 UTSW 15 78,798,224 (GRCm39) missense probably benign
PIT4585001:Sh3bp1 UTSW 15 78,794,276 (GRCm39) missense possibly damaging 0.49
R0255:Sh3bp1 UTSW 15 78,788,534 (GRCm39) nonsense probably null
R0318:Sh3bp1 UTSW 15 78,795,907 (GRCm39) missense probably damaging 0.97
R0544:Sh3bp1 UTSW 15 78,789,975 (GRCm39) missense probably damaging 1.00
R0554:Sh3bp1 UTSW 15 78,791,467 (GRCm39) missense probably damaging 1.00
R1424:Sh3bp1 UTSW 15 78,787,899 (GRCm39) critical splice donor site probably null
R1465:Sh3bp1 UTSW 15 78,791,545 (GRCm39) splice site probably benign
R1813:Sh3bp1 UTSW 15 78,787,880 (GRCm39) missense probably damaging 0.96
R1835:Sh3bp1 UTSW 15 78,789,350 (GRCm39) missense probably damaging 1.00
R2291:Sh3bp1 UTSW 15 78,802,519 (GRCm39) missense possibly damaging 0.93
R2415:Sh3bp1 UTSW 15 78,785,361 (GRCm39) start gained probably benign
R2509:Sh3bp1 UTSW 15 78,795,706 (GRCm39) missense probably damaging 1.00
R2511:Sh3bp1 UTSW 15 78,795,706 (GRCm39) missense probably damaging 1.00
R3054:Sh3bp1 UTSW 15 78,795,622 (GRCm39) missense probably benign 0.01
R3827:Sh3bp1 UTSW 15 78,788,697 (GRCm39) missense possibly damaging 0.67
R3855:Sh3bp1 UTSW 15 78,785,361 (GRCm39) start gained probably benign
R4787:Sh3bp1 UTSW 15 78,792,195 (GRCm39) missense possibly damaging 0.80
R4852:Sh3bp1 UTSW 15 78,788,538 (GRCm39) missense probably benign 0.01
R4872:Sh3bp1 UTSW 15 78,792,237 (GRCm39) missense probably benign 0.31
R5194:Sh3bp1 UTSW 15 78,787,301 (GRCm39) missense probably damaging 1.00
R6320:Sh3bp1 UTSW 15 78,795,715 (GRCm39) missense probably damaging 1.00
R6322:Sh3bp1 UTSW 15 78,795,715 (GRCm39) missense probably damaging 1.00
R6569:Sh3bp1 UTSW 15 78,795,896 (GRCm39) missense probably damaging 1.00
R6678:Sh3bp1 UTSW 15 78,792,714 (GRCm39) critical splice donor site probably null
R6905:Sh3bp1 UTSW 15 78,789,230 (GRCm39) missense probably benign 0.00
R7564:Sh3bp1 UTSW 15 78,795,760 (GRCm39) missense probably damaging 1.00
R7744:Sh3bp1 UTSW 15 78,794,209 (GRCm39) missense possibly damaging 0.61
R7916:Sh3bp1 UTSW 15 78,791,421 (GRCm39) missense probably benign 0.01
R8048:Sh3bp1 UTSW 15 78,794,272 (GRCm39) missense probably benign 0.26
R8887:Sh3bp1 UTSW 15 78,788,540 (GRCm39) critical splice donor site probably null
R9043:Sh3bp1 UTSW 15 78,791,449 (GRCm39) missense possibly damaging 0.71
R9057:Sh3bp1 UTSW 15 78,794,209 (GRCm39) missense probably benign 0.00
R9548:Sh3bp1 UTSW 15 78,788,673 (GRCm39) missense possibly damaging 0.94
R9666:Sh3bp1 UTSW 15 78,792,622 (GRCm39) missense probably benign 0.10
Z1177:Sh3bp1 UTSW 15 78,786,772 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAAGGAGGATTCTTATGCC -3'
(R):5'- ATTCAACCATAGCTCCCTACTG -3'

Sequencing Primer
(F):5'- CAAGGAGGATTCTTATGCCAACTAC -3'
(R):5'- AACTCTCTATGGAGACTAGGCTGC -3'
Posted On 2015-12-21