Incidental Mutation 'R4767:Eva1c'
ID 366245
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Name eva-1 homolog C
Synonyms 4931408A02Rik, 1700092M14Rik, Fam176c
MMRRC Submission 042408-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4767 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90623607-90701997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90701235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 290 (Y290F)
Ref Sequence ENSEMBL: ENSMUSP00000156225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000231280] [ENSMUST00000231964]
AlphaFold P58659
Predicted Effect probably damaging
Transcript: ENSMUST00000037539
AA Change: Y397F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903
AA Change: Y397F

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099543
AA Change: Y349F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903
AA Change: Y349F

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099548
AA Change: Y403F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903
AA Change: Y403F

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231280
AA Change: Y290F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231964
AA Change: Y302F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232665
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,029,804 (GRCm39) probably null Het
Aig1 T C 10: 13,677,602 (GRCm39) N130S probably damaging Het
Alx1 A T 10: 102,861,047 (GRCm39) Y160* probably null Het
Ap4e1 T C 2: 126,902,358 (GRCm39) I755T probably benign Het
Apoc3 C A 9: 46,145,833 (GRCm39) E21* probably null Het
Atp9b G T 18: 80,796,285 (GRCm39) H919Q probably damaging Het
Cemip T G 7: 83,622,514 (GRCm39) Y555S probably damaging Het
Cic T C 7: 24,971,025 (GRCm39) V252A possibly damaging Het
Cracr2a A T 6: 127,588,470 (GRCm39) N210Y probably damaging Het
Crocc2 G A 1: 93,130,578 (GRCm39) R953Q possibly damaging Het
Csnk1d A G 11: 120,859,954 (GRCm39) S318P probably benign Het
Ddx21 A G 10: 62,427,751 (GRCm39) L384P probably damaging Het
Dnah5 C T 15: 28,270,620 (GRCm39) T974I probably benign Het
Duox1 A G 2: 122,163,922 (GRCm39) Y863C possibly damaging Het
Epg5 C A 18: 78,066,498 (GRCm39) P2133T possibly damaging Het
Ephb6 A T 6: 41,591,119 (GRCm39) Q92L possibly damaging Het
Ercc4 C A 16: 12,939,959 (GRCm39) A73D probably damaging Het
Galnt5 T A 2: 57,918,156 (GRCm39) V798E possibly damaging Het
Haus4 T C 14: 54,786,342 (GRCm39) E149G probably damaging Het
Ighv1-13 A G 12: 114,594,556 (GRCm39) Y86C unknown Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Lama3 T C 18: 12,633,620 (GRCm39) V1584A probably benign Het
Lamb1 A G 12: 31,358,010 (GRCm39) E1119G probably damaging Het
Lao1 T C 4: 118,825,185 (GRCm39) L335P probably damaging Het
Mindy4 A G 6: 55,237,550 (GRCm39) D375G probably damaging Het
Myo5a T C 9: 75,051,358 (GRCm39) I317T probably damaging Het
Nhlrc2 G A 19: 56,558,898 (GRCm39) V128I probably benign Het
Nlrp2 C T 7: 5,331,023 (GRCm39) D458N probably damaging Het
Or1j18 A T 2: 36,624,335 (GRCm39) M1L probably benign Het
Or1o1 T A 17: 37,717,091 (GRCm39) C217* probably null Het
Or5a1 G T 19: 12,097,300 (GRCm39) H247N probably damaging Het
Or8g24 T C 9: 38,989,988 (GRCm39) T18A possibly damaging Het
Or9q2 A T 19: 13,772,409 (GRCm39) C189S probably damaging Het
Parp8 T C 13: 117,005,072 (GRCm39) H663R probably damaging Het
Pax6 T C 2: 105,525,705 (GRCm39) S377P probably benign Het
Pi15 A G 1: 17,672,990 (GRCm39) D63G probably benign Het
Plaa A G 4: 94,474,495 (GRCm39) probably benign Het
Rbm5 C A 9: 107,622,412 (GRCm39) W546C probably damaging Het
Rnf123 C A 9: 107,929,288 (GRCm39) C1257F probably damaging Het
Rnf185 A G 11: 3,382,551 (GRCm39) S45P possibly damaging Het
Sh3bp1 T C 15: 78,788,697 (GRCm39) S241P possibly damaging Het
Slfn8 G A 11: 82,894,023 (GRCm39) A872V possibly damaging Het
Smoc1 G A 12: 81,151,547 (GRCm39) probably null Het
Sox14 A T 9: 99,757,686 (GRCm39) W18R probably damaging Het
Spata31d1a T C 13: 59,848,969 (GRCm39) E1053G probably benign Het
Syne1 T A 10: 5,294,866 (GRCm39) K1246* probably null Het
Tbrg4 A C 11: 6,570,909 (GRCm39) S188A probably benign Het
Thnsl2 A T 6: 71,111,279 (GRCm39) D196E probably damaging Het
Tmem266 C T 9: 55,288,025 (GRCm39) T34I probably damaging Het
Tmem59l C A 8: 70,938,748 (GRCm39) R111L probably benign Het
Tpr T C 1: 150,306,280 (GRCm39) probably benign Het
Trpc6 T C 9: 8,643,687 (GRCm39) S491P probably damaging Het
Tspan10 A T 11: 120,336,992 (GRCm39) N254I probably damaging Het
Ubox5 A T 2: 130,433,814 (GRCm39) L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 23,754,531 (GRCm39) probably null Het
Vmn2r4 C T 3: 64,298,397 (GRCm39) C577Y probably damaging Het
Vmn2r86 A T 10: 130,291,606 (GRCm39) M53K probably benign Het
Zfp948 T A 17: 21,808,569 (GRCm39) I587N possibly damaging Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90,701,235 (GRCm39) missense probably damaging 1.00
IGL02061:Eva1c APN 16 90,663,163 (GRCm39) nonsense probably null
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90,672,986 (GRCm39) missense probably benign 0.03
R1330:Eva1c UTSW 16 90,701,284 (GRCm39) missense probably damaging 1.00
R1765:Eva1c UTSW 16 90,701,135 (GRCm39) missense probably benign 0.01
R1824:Eva1c UTSW 16 90,663,331 (GRCm39) missense probably benign 0.01
R1880:Eva1c UTSW 16 90,694,303 (GRCm39) missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90,628,213 (GRCm39) missense probably benign 0.12
R4072:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4076:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4622:Eva1c UTSW 16 90,694,343 (GRCm39) critical splice donor site probably null
R4760:Eva1c UTSW 16 90,701,138 (GRCm39) missense probably benign 0.37
R5024:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R5304:Eva1c UTSW 16 90,666,551 (GRCm39) missense probably damaging 1.00
R5559:Eva1c UTSW 16 90,701,139 (GRCm39) missense probably benign 0.06
R6605:Eva1c UTSW 16 90,663,236 (GRCm39) missense probably damaging 1.00
R7222:Eva1c UTSW 16 90,701,072 (GRCm39) small deletion probably benign
R7409:Eva1c UTSW 16 90,666,544 (GRCm39) missense probably damaging 1.00
R7449:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R8489:Eva1c UTSW 16 90,672,999 (GRCm39) missense probably damaging 1.00
R8687:Eva1c UTSW 16 90,687,433 (GRCm39) missense probably benign 0.42
R9091:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
R9270:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTCATGTCCAGTGTCTGCATC -3'
(R):5'- GACCCTTCCTTCTTCAGAGAG -3'

Sequencing Primer
(F):5'- ACTGTGTGCCCTGGTCATCAG -3'
(R):5'- AGAGAGTCTGATCTCCTCCAGATG -3'
Posted On 2015-12-21