Incidental Mutation 'R4767:Atp9b'
ID366250
Institutional Source Beutler Lab
Gene Symbol Atp9b
Ensembl Gene ENSMUSG00000024566
Gene NameATPase, class II, type 9B
SynonymsIIb
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80734141-80934058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80753070 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 919 (H919Q)
Ref Sequence ENSEMBL: ENSMUSP00000089394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091790] [ENSMUST00000225235] [ENSMUST00000225980]
Predicted Effect probably damaging
Transcript: ENSMUST00000091790
AA Change: H919Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089394
Gene: ENSMUSG00000024566
AA Change: H919Q

DomainStartEndE-ValueType
low complexity region 11 39 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 110 181 5.3e-21 PFAM
Pfam:E1-E2_ATPase 186 444 9.1e-15 PFAM
Pfam:Hydrolase 463 885 2.7e-13 PFAM
Pfam:HAD 464 882 4.8e-14 PFAM
Pfam:Cation_ATPase 563 664 3.7e-7 PFAM
Pfam:PhoLip_ATPase_C 899 1128 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224283
Predicted Effect probably benign
Transcript: ENSMUST00000225092
Predicted Effect probably benign
Transcript: ENSMUST00000225218
Predicted Effect probably benign
Transcript: ENSMUST00000225235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225692
Predicted Effect probably damaging
Transcript: ENSMUST00000225980
AA Change: H919Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9674 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Atp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Atp9b APN 18 80917888 intron probably benign
IGL00769:Atp9b APN 18 80912853 missense probably benign 0.08
IGL00851:Atp9b APN 18 80765910 missense probably damaging 1.00
IGL01529:Atp9b APN 18 80844611 intron probably benign
IGL01637:Atp9b APN 18 80756455 missense probably benign 0.06
IGL01973:Atp9b APN 18 80758303 missense probably benign 0.02
IGL02082:Atp9b APN 18 80891930 intron probably benign
IGL02560:Atp9b APN 18 80762198 missense probably benign 0.23
IGL02981:Atp9b APN 18 80754289 missense possibly damaging 0.93
IGL03151:Atp9b APN 18 80776850 missense probably benign 0.28
IGL03304:Atp9b APN 18 80917877 missense probably damaging 1.00
IGL03348:Atp9b APN 18 80836422 missense possibly damaging 0.88
R0056:Atp9b UTSW 18 80765803 missense probably damaging 0.99
R0355:Atp9b UTSW 18 80909585 intron probably benign
R0366:Atp9b UTSW 18 80762102 missense probably damaging 1.00
R0557:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R0612:Atp9b UTSW 18 80753956 missense possibly damaging 0.81
R1099:Atp9b UTSW 18 80858626 missense probably damaging 1.00
R1126:Atp9b UTSW 18 80778954 missense probably damaging 1.00
R1499:Atp9b UTSW 18 80762138 missense probably damaging 0.99
R1499:Atp9b UTSW 18 80778907 missense probably benign 0.02
R1764:Atp9b UTSW 18 80909591 critical splice donor site probably null
R1780:Atp9b UTSW 18 80776897 nonsense probably null
R1782:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R1835:Atp9b UTSW 18 80778883 missense probably benign 0.00
R1859:Atp9b UTSW 18 80749920 missense possibly damaging 0.95
R1953:Atp9b UTSW 18 80754307 missense possibly damaging 0.80
R2140:Atp9b UTSW 18 80736087 missense probably damaging 0.99
R2191:Atp9b UTSW 18 80753051 missense probably damaging 1.00
R4118:Atp9b UTSW 18 80749829 missense possibly damaging 0.83
R4605:Atp9b UTSW 18 80753149 critical splice acceptor site probably null
R4654:Atp9b UTSW 18 80891878 missense probably benign 0.00
R4775:Atp9b UTSW 18 80765769 critical splice donor site probably null
R4936:Atp9b UTSW 18 80736093 missense possibly damaging 0.58
R5096:Atp9b UTSW 18 80762184 missense probably benign 0.39
R5279:Atp9b UTSW 18 80912858 missense probably damaging 0.98
R5394:Atp9b UTSW 18 80776837 missense probably benign 0.16
R5774:Atp9b UTSW 18 80933932 missense probably damaging 0.96
R5877:Atp9b UTSW 18 80752789 missense probably benign
R6080:Atp9b UTSW 18 80738808 missense probably benign 0.03
R6170:Atp9b UTSW 18 80877347 missense probably benign 0.16
R6250:Atp9b UTSW 18 80756521 missense probably benign 0.01
R6340:Atp9b UTSW 18 80778900 missense probably benign 0.38
R6498:Atp9b UTSW 18 80777015 missense probably benign 0.03
R6620:Atp9b UTSW 18 80808687 nonsense probably null
R6632:Atp9b UTSW 18 80808649 missense probably damaging 1.00
R6665:Atp9b UTSW 18 80917735 missense probably benign 0.26
R6821:Atp9b UTSW 18 80847248 missense probably damaging 1.00
R6927:Atp9b UTSW 18 80891857 missense possibly damaging 0.63
R6977:Atp9b UTSW 18 80753102 missense probably damaging 1.00
R7133:Atp9b UTSW 18 80909656 missense
R7188:Atp9b UTSW 18 80917826 missense
R7396:Atp9b UTSW 18 80736842 missense
R7432:Atp9b UTSW 18 80765841 missense
R7457:Atp9b UTSW 18 80917618 intron probably null
R7877:Atp9b UTSW 18 80847197 missense
R7960:Atp9b UTSW 18 80847197 missense
R8072:Atp9b UTSW 18 80765061 missense
Z1176:Atp9b UTSW 18 80765865 missense
Predicted Primers PCR Primer
(F):5'- GTGACACCCAGTAAGTCCAG -3'
(R):5'- AGGTTCTAGTACAGTCTCCTCTACC -3'

Sequencing Primer
(F):5'- GTAAGTCCAGCGTAACTCCC -3'
(R):5'- CCATGCTAGGGGTCAAGCAG -3'
Posted On2015-12-21