Incidental Mutation 'R4768:Slc9a2'
ID 366254
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms 2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission 042409-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R4768 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 40680574-40769273 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 40726374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 308 (R308Q)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
AlphaFold Q3ZAS0
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: R308Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: R308Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192345
AA Change: R308Q

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: R308Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Cmas T C 6: 142,764,431 probably null Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mrgpra3 C A 7: 47,589,728 R150L possibly damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Olfr922 T A 9: 38,815,949 Y149N probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Vmn2r65 A G 7: 84,947,394 L151P probably damaging Het
Xylt2 T C 11: 94,670,472 D155G probably benign Het
Zzz3 A G 3: 152,448,783 D557G probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
putty UTSW 1 40742653 nonsense probably null
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
R7670:Slc9a2 UTSW 1 40718997 missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40726214 missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40718649 missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8887:Slc9a2 UTSW 1 40718849 missense probably benign 0.01
R9028:Slc9a2 UTSW 1 40726452 missense probably damaging 1.00
R9189:Slc9a2 UTSW 1 40755784 missense probably benign 0.21
R9245:Slc9a2 UTSW 1 40766300 missense probably benign 0.27
R9250:Slc9a2 UTSW 1 40767827 missense probably benign 0.00
R9400:Slc9a2 UTSW 1 40719051 missense possibly damaging 0.65
R9512:Slc9a2 UTSW 1 40682098 missense probably damaging 0.98
R9583:Slc9a2 UTSW 1 40681901 missense probably benign
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40767711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCCTCAGGTCCTGTACAAC -3'
(R):5'- CAGCTCCACATTGCAGTAGC -3'

Sequencing Primer
(F):5'- CAGGTCCTGTACAACTTGTTCAAG -3'
(R):5'- CTTTCATTTCGGTGTAACAAAAGG -3'
Posted On 2015-12-21