Mutagenetix > Incidental Mutation

Incidental Mutation 'R4768:Slc9a2'

366254

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

042409-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R4768 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40726374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 308 (R308Q)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027231
AA Change: R308Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: R308Q

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192345
AA Change: R308Q

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: R308Q

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933408B17Rik	T	C	18: 34,580,952	R207G	probably damaging	Het
Acadm	A	G	3: 153,922,942	Y419H	probably benign	Het
Adam28	A	G	14: 68,634,815	V326A	possibly damaging	Het
Amdhd1	T	A	10: 93,534,484	E164V	possibly damaging	Het
Arhgap5	T	C	12: 52,557,492	L29S	probably damaging	Het
Asb5	G	A	8: 54,584,996	D185N	probably benign	Het
Ascc3	T	C	10: 50,700,499	I850T	probably damaging	Het
Atxn1	A	G	13: 45,557,548	V636A	probably damaging	Het
Bmp4	C	T	14: 46,385,924	R55Q	probably damaging	Het
Cmas	T	C	6: 142,764,431		probably null	Het
Dchs1	T	C	7: 105,771,620	D531G	possibly damaging	Het
Etv1	T	C	12: 38,827,793	L44P	probably damaging	Het
Fam13c	T	A	10: 70,551,750	I448N	probably damaging	Het
Fuk	T	C	8: 110,892,134	T331A	probably benign	Het
Fut8	A	G	12: 77,365,280	K135E	probably benign	Het
Gabrg1	A	G	5: 70,754,173	F370S	probably damaging	Het
Ighv1-5	A	T	12: 114,513,523	M53K	probably damaging	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Kansl1l	A	G	1: 66,801,133	V336A	probably damaging	Het
Krt27	T	A	11: 99,349,525	D189V	probably damaging	Het
Marf1	A	T	16: 14,131,597	F1033I	possibly damaging	Het
Mdfi	G	A	17: 47,824,550	T85M	probably damaging	Het
Mrgpra3	C	A	7: 47,589,728	R150L	possibly damaging	Het
Mst1r	C	A	9: 107,911,650	T456K	probably damaging	Het
Myh14	A	T	7: 44,613,675	M1734K	probably benign	Het
Myo1e	T	C	9: 70,370,469	I816T	possibly damaging	Het
Olfr1066	A	T	2: 86,455,650	L207*	probably null	Het
Olfr77	A	C	9: 19,920,545	N112T	possibly damaging	Het
Olfr874	T	C	9: 37,746,881	L249P	probably damaging	Het
Olfr922	T	A	9: 38,815,949	Y149N	probably damaging	Het
Pde4d	A	G	13: 109,933,874	R6G	probably damaging	Het
Pilrb1	G	A	5: 137,857,526		probably benign	Het
Prrx1	A	G	1: 163,257,765	Y199H	probably damaging	Het
Rxfp1	T	C	3: 79,686,868	D73G	probably damaging	Het
Ryr1	G	T	7: 29,004,821		probably benign	Het
Shprh	A	G	10: 11,181,540	E1068G	probably damaging	Het
Slc19a3	G	A	1: 83,023,113	T61I	probably damaging	Het
Suclg2	T	G	6: 95,566,488	I321L	probably damaging	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Ttn	C	T	2: 76,768,766		probably benign	Het
Upp2	T	C	2: 58,777,895	V182A	probably damaging	Het
Vmn2r65	A	G	7: 84,947,394	L151P	probably damaging	Het
Xylt2	T	C	11: 94,670,472	D155G	probably benign	Het
Zzz3	A	G	3: 152,448,783	D557G	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCCCTCAGGTCCTGTACAAC -3'
(R):5'- CAGCTCCACATTGCAGTAGC -3'

Sequencing Primer
(F):5'- CAGGTCCTGTACAACTTGTTCAAG -3'
(R):5'- CTTTCATTTCGGTGTAACAAAAGG -3'

Posted On

2015-12-21