Incidental Mutation 'R4768:Zzz3'
ID 366265
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
MMRRC Submission 042409-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4768 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152448783 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 557 (D557G)
Ref Sequence ENSEMBL: ENSMUSP00000087428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000089982
AA Change: D557G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: D557G

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106100
AA Change: D557G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: D557G

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106101
AA Change: D557G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: D557G

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106103
AA Change: D56G

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068
AA Change: D56G

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197987
Predicted Effect possibly damaging
Transcript: ENSMUST00000200570
AA Change: D61G

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068
AA Change: D61G

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Cmas T C 6: 142,764,431 probably null Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mrgpra3 C A 7: 47,589,728 R150L possibly damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Olfr922 T A 9: 38,815,949 Y149N probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Vmn2r65 A G 7: 84,947,394 L151P probably damaging Het
Xylt2 T C 11: 94,670,472 D155G probably benign Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9143:Zzz3 UTSW 3 152458271 missense probably benign 0.04
R9243:Zzz3 UTSW 3 152428283 missense probably damaging 1.00
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAAAGTTGCTGCCGGTACACTC -3'
(R):5'- TTTTGGTCTAGCGGGCAAC -3'

Sequencing Primer
(F):5'- GGTACACTCTGCATCGCTG -3'
(R):5'- TAGGACACTACAAGACATTTTCCTC -3'
Posted On 2015-12-21