Incidental Mutation 'R4768:Cmas'
ID366270
Institutional Source Beutler Lab
Gene Symbol Cmas
Ensembl Gene ENSMUSG00000030282
Gene Namecytidine monophospho-N-acetylneuraminic acid synthetase
SynonymsCMP-Neu5Ac synthase, CMP-sialic acid synthetase, D6Bwg0250e
MMRRC Submission 042409-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R4768 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142756686-142775714 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 142764431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032419] [ENSMUST00000133248] [ENSMUST00000144920]
Predicted Effect probably null
Transcript: ENSMUST00000032419
SMART Domains Protein: ENSMUSP00000032419
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 301 3.8e-69 PFAM
Pfam:NTP_transf_3 45 228 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133248
SMART Domains Protein: ENSMUSP00000144875
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144920
SMART Domains Protein: ENSMUSP00000145392
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204147
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that converts N-acetylneuraminic acid (NeuNAc) to cytidine 5'-monophosphate N-acetylneuraminic acid (CMP-NeuNAc). This process is important in the formation of sialylated glycoprotein and glycolipids. This modification plays a role in cell-cell communications and immune responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mrgpra3 C A 7: 47,589,728 R150L possibly damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Olfr922 T A 9: 38,815,949 Y149N probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Vmn2r65 A G 7: 84,947,394 L151P probably damaging Het
Xylt2 T C 11: 94,670,472 D155G probably benign Het
Zzz3 A G 3: 152,448,783 D557G probably damaging Het
Other mutations in Cmas
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Cmas UTSW 6 142775244 nonsense probably null
R0798:Cmas UTSW 6 142764656 missense probably damaging 1.00
R1172:Cmas UTSW 6 142756878 missense probably benign 0.01
R1453:Cmas UTSW 6 142772127 missense probably damaging 1.00
R1983:Cmas UTSW 6 142770586 missense probably damaging 0.98
R2147:Cmas UTSW 6 142771289 missense probably benign 0.18
R3795:Cmas UTSW 6 142767868 missense probably benign 0.03
R4378:Cmas UTSW 6 142772285 unclassified probably benign
R6430:Cmas UTSW 6 142767924 missense probably benign
R6774:Cmas UTSW 6 142764421 missense possibly damaging 0.81
R6824:Cmas UTSW 6 142771236 missense possibly damaging 0.90
R6980:Cmas UTSW 6 142756800 missense probably damaging 0.97
R7256:Cmas UTSW 6 142770586 missense probably damaging 1.00
R7776:Cmas UTSW 6 142764557 missense probably damaging 0.99
R7969:Cmas UTSW 6 142775166 missense probably damaging 1.00
R8325:Cmas UTSW 6 142771339 critical splice donor site probably null
R8363:Cmas UTSW 6 142756828 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTCCCTTCTGGTGACTCTG -3'
(R):5'- CGGATCATTTCTGCAACTTTCTGG -3'

Sequencing Primer
(F):5'- CCTTCTGGTGACTCTGTTATTTAAC -3'
(R):5'- CTGCAACTTTCTGGAGGTCAG -3'
Posted On2015-12-21