Incidental Mutation 'R4768:Mrgpra3'
ID366273
Institutional Source Beutler Lab
Gene Symbol Mrgpra3
Ensembl Gene ENSMUSG00000078698
Gene NameMAS-related GPR, member A3
SynonymsG protein-coupled receptor, MrgA3
MMRRC Submission 042409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4768 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location47588950-47601372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47589728 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 150 (R150L)
Ref Sequence ENSEMBL: ENSMUSP00000135437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176369
AA Change: R150L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135437
Gene: ENSMUSG00000078698
AA Change: R150L

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 48 234 6.3e-7 PFAM
Pfam:7tm_1 57 286 2.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Cmas T C 6: 142,764,431 probably null Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Olfr922 T A 9: 38,815,949 Y149N probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Vmn2r65 A G 7: 84,947,394 L151P probably damaging Het
Xylt2 T C 11: 94,670,472 D155G probably benign Het
Zzz3 A G 3: 152,448,783 D557G probably damaging Het
Other mutations in Mrgpra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Mrgpra3 APN 7 47589519 missense probably benign 0.00
IGL02097:Mrgpra3 APN 7 47589456 missense possibly damaging 0.94
IGL02101:Mrgpra3 APN 7 47589552 missense probably damaging 0.99
IGL03071:Mrgpra3 APN 7 47589181 utr 3 prime probably benign
PIT4445001:Mrgpra3 UTSW 7 47590160 missense possibly damaging 0.88
R0828:Mrgpra3 UTSW 7 47590136 missense probably benign 0.12
R1118:Mrgpra3 UTSW 7 47589291 missense possibly damaging 0.83
R1835:Mrgpra3 UTSW 7 47589946 nonsense probably null
R2258:Mrgpra3 UTSW 7 47590094 missense probably benign 0.35
R2393:Mrgpra3 UTSW 7 47589617 missense possibly damaging 0.92
R3437:Mrgpra3 UTSW 7 47589566 missense probably damaging 1.00
R3973:Mrgpra3 UTSW 7 47589666 missense probably benign 0.22
R4273:Mrgpra3 UTSW 7 47589432 missense probably benign 0.01
R4495:Mrgpra3 UTSW 7 47590065 missense probably benign 0.00
R4822:Mrgpra3 UTSW 7 47589968 missense possibly damaging 0.69
R4967:Mrgpra3 UTSW 7 47589519 missense probably benign 0.33
R5207:Mrgpra3 UTSW 7 47590161 missense probably benign 0.06
R5569:Mrgpra3 UTSW 7 47590011 missense probably benign 0.00
R5763:Mrgpra3 UTSW 7 47589607 nonsense probably null
R6102:Mrgpra3 UTSW 7 47590149 missense possibly damaging 0.92
R6612:Mrgpra3 UTSW 7 47590035 missense probably benign 0.00
R6718:Mrgpra3 UTSW 7 47589696 missense probably benign 0.25
R6859:Mrgpra3 UTSW 7 47590033 missense probably benign 0.04
R7029:Mrgpra3 UTSW 7 47589542 missense probably benign 0.00
R7034:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7036:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7097:Mrgpra3 UTSW 7 47589641 missense probably benign
R7475:Mrgpra3 UTSW 7 47589947 missense probably damaging 1.00
R8289:Mrgpra3 UTSW 7 47589720 missense possibly damaging 0.76
R8315:Mrgpra3 UTSW 7 47601303 start codon destroyed probably null 0.93
Z1177:Mrgpra3 UTSW 7 47601301 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAACAACCTGGCCAGTAGAG -3'
(R):5'- TAAACTTGGCCCTGGCTGAC -3'

Sequencing Primer
(F):5'- TGGCCAGTAGAGCCAGG -3'
(R):5'- TCTCTGTCACATCATAAATTCCACAG -3'
Posted On2015-12-21