Incidental Mutation 'R4768:Vmn2r65'
ID366274
Institutional Source Beutler Lab
Gene Symbol Vmn2r65
Ensembl Gene ENSMUSG00000066372
Gene Namevomeronasal 2, receptor 65
SynonymsENSMUSG00000070600
MMRRC Submission 042409-MU
Accession Numbers

Genbank: NM_001105180; MGI: 3642776

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4768 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location84940169-84964009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84947394 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 151 (L151P)
Ref Sequence ENSEMBL: ENSMUSP00000036551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044583]
Predicted Effect probably damaging
Transcript: ENSMUST00000044583
AA Change: L151P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036551
Gene: ENSMUSG00000066372
AA Change: L151P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 435 5.6e-41 PFAM
Pfam:NCD3G 501 553 1.3e-21 PFAM
Pfam:7tm_3 584 821 2.3e-53 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Cmas T C 6: 142,764,431 probably null Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mrgpra3 C A 7: 47,589,728 R150L possibly damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Olfr922 T A 9: 38,815,949 Y149N probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Xylt2 T C 11: 94,670,472 D155G probably benign Het
Zzz3 A G 3: 152,448,783 D557G probably damaging Het
Other mutations in Vmn2r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Vmn2r65 APN 7 84943553 missense probably damaging 0.99
IGL01104:Vmn2r65 APN 7 84940788 missense possibly damaging 0.93
IGL01154:Vmn2r65 APN 7 84943521 missense probably benign 0.00
IGL01453:Vmn2r65 APN 7 84940500 missense probably damaging 1.00
IGL01675:Vmn2r65 APN 7 84947379 missense probably benign 0.00
IGL01748:Vmn2r65 APN 7 84940299 missense probably damaging 1.00
IGL01997:Vmn2r65 APN 7 84940770 missense probably damaging 1.00
IGL02527:Vmn2r65 APN 7 84946516 missense possibly damaging 0.82
IGL02617:Vmn2r65 APN 7 84940341 missense probably damaging 1.00
IGL02676:Vmn2r65 APN 7 84940173 missense possibly damaging 0.86
IGL03084:Vmn2r65 APN 7 84943146 missense probably damaging 1.00
A4554:Vmn2r65 UTSW 7 84946583 missense probably damaging 0.96
PIT4651001:Vmn2r65 UTSW 7 84946253 missense probably benign 0.12
R0322:Vmn2r65 UTSW 7 84946548 missense probably benign 0.01
R0453:Vmn2r65 UTSW 7 84946234 missense probably benign 0.03
R0862:Vmn2r65 UTSW 7 84943645 missense probably benign 0.00
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1508:Vmn2r65 UTSW 7 84940678 missense probably benign 0.00
R1687:Vmn2r65 UTSW 7 84940818 missense probably benign 0.02
R1876:Vmn2r65 UTSW 7 84946297 missense probably damaging 1.00
R2136:Vmn2r65 UTSW 7 84943573 missense probably damaging 0.96
R2259:Vmn2r65 UTSW 7 84940911 missense possibly damaging 0.86
R2338:Vmn2r65 UTSW 7 84940843 missense possibly damaging 0.86
R2880:Vmn2r65 UTSW 7 84963886 missense probably damaging 1.00
R3410:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3411:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3770:Vmn2r65 UTSW 7 84940415 missense probably damaging 1.00
R3800:Vmn2r65 UTSW 7 84940530 missense possibly damaging 0.93
R3850:Vmn2r65 UTSW 7 84946651 missense probably benign 0.00
R4105:Vmn2r65 UTSW 7 84946483 missense probably benign 0.03
R4568:Vmn2r65 UTSW 7 84947469 missense probably damaging 1.00
R4677:Vmn2r65 UTSW 7 84963874 missense possibly damaging 0.55
R4778:Vmn2r65 UTSW 7 84943593 missense possibly damaging 0.47
R5057:Vmn2r65 UTSW 7 84940611 missense probably damaging 1.00
R5279:Vmn2r65 UTSW 7 84940641 missense probably damaging 1.00
R5280:Vmn2r65 UTSW 7 84946334 missense probably damaging 0.99
R5394:Vmn2r65 UTSW 7 84946654 missense probably benign 0.04
R5487:Vmn2r65 UTSW 7 84946321 missense possibly damaging 0.76
R5580:Vmn2r65 UTSW 7 84947594 missense probably damaging 0.99
R5638:Vmn2r65 UTSW 7 84940839 missense probably damaging 1.00
R5673:Vmn2r65 UTSW 7 84947407 missense probably benign 0.23
R5688:Vmn2r65 UTSW 7 84940692 missense probably benign 0.00
R5935:Vmn2r65 UTSW 7 84943661 missense probably benign 0.00
R6354:Vmn2r65 UTSW 7 84940366 missense probably benign 0.35
R6372:Vmn2r65 UTSW 7 84940653 missense probably damaging 1.00
R6924:Vmn2r65 UTSW 7 84963990 missense probably benign 0.20
R7021:Vmn2r65 UTSW 7 84947379 missense probably benign 0.00
R7195:Vmn2r65 UTSW 7 84943139 critical splice donor site probably null
R7422:Vmn2r65 UTSW 7 84946361 missense probably damaging 0.99
R7654:Vmn2r65 UTSW 7 84941053 missense probably damaging 1.00
R7686:Vmn2r65 UTSW 7 84940536 missense probably damaging 0.99
R7691:Vmn2r65 UTSW 7 84943643 missense probably benign 0.30
R7798:Vmn2r65 UTSW 7 84946322 missense probably benign 0.00
R7798:Vmn2r65 UTSW 7 84946984 missense probably damaging 1.00
X0067:Vmn2r65 UTSW 7 84940905 missense probably benign 0.04
Z1088:Vmn2r65 UTSW 7 84943265 critical splice acceptor site probably null
Z1177:Vmn2r65 UTSW 7 84941026 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATGTCATGTATGTGCCAGAAAATG -3'
(R):5'- CAGAAATATCCACCTGATTTTGGCTC -3'

Sequencing Primer
(F):5'- ATGTGCCAGAAAATGATAATTTAAGC -3'
(R):5'- ATATCCACCTGATTTTGGCTCTATTG -3'
Posted On2015-12-21