Incidental Mutation 'R4768:Xylt2'
ID366289
Institutional Source Beutler Lab
Gene Symbol Xylt2
Ensembl Gene ENSMUSG00000020868
Gene Namexylosyltransferase II
SynonymsE030002B02Rik
MMRRC Submission 042409-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R4768 (G1)
Quality Score207
Status Not validated
Chromosome11
Chromosomal Location94663851-94677515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94670472 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 155 (D155G)
Ref Sequence ENSEMBL: ENSMUSP00000122581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116349] [ENSMUST00000146693] [ENSMUST00000150377] [ENSMUST00000153485]
Predicted Effect probably benign
Transcript: ENSMUST00000116349
AA Change: D155G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112052
Gene: ENSMUSG00000020868
AA Change: D155G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.9e-60 PFAM
Pfam:Xylo_C 519 699 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146693
Predicted Effect probably benign
Transcript: ENSMUST00000150377
SMART Domains Protein: ENSMUSP00000134495
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
Pfam:Xylo_C 31 97 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153485
AA Change: D155G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122581
Gene: ENSMUSG00000020868
AA Change: D155G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.1e-59 PFAM
Pfam:Xylo_C 519 594 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154830
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isoform of xylosyltransferase, which belongs to a family of glycosyltransferases. This enzyme transfers xylose from UDP-xylose to specific serine residues of the core protein and initiates the biosynthesis of glycosaminoglycan chains in proteoglycans including chondroitin sulfate, heparan sulfate, heparin and dermatan sulfate. The enzyme activity, which is increased in scleroderma patients, is a diagnostic marker for the determination of sclerotic activity in systemic sclerosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele lack most liver proteoglycans and develop many aspects of polycystic liver and kidney disease, including biliary tract hyperplasia, liver fibrosis, biliary cysts, renal tubule dilation, basement membrane abnormalities and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Cmas T C 6: 142,764,431 probably null Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mrgpra3 C A 7: 47,589,728 R150L possibly damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Olfr922 T A 9: 38,815,949 Y149N probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Vmn2r65 A G 7: 84,947,394 L151P probably damaging Het
Zzz3 A G 3: 152,448,783 D557G probably damaging Het
Other mutations in Xylt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02048:Xylt2 APN 11 94666345 missense possibly damaging 0.61
IGL02421:Xylt2 APN 11 94667762 missense possibly damaging 0.45
P0040:Xylt2 UTSW 11 94668791 missense possibly damaging 0.46
PIT4585001:Xylt2 UTSW 11 94666240 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0313:Xylt2 UTSW 11 94669894 splice site probably benign
R0449:Xylt2 UTSW 11 94666333 missense probably benign 0.22
R0511:Xylt2 UTSW 11 94669936 nonsense probably null
R1483:Xylt2 UTSW 11 94669567 missense probably benign 0.04
R1511:Xylt2 UTSW 11 94670433 missense probably damaging 1.00
R1565:Xylt2 UTSW 11 94667594 missense probably benign
R1616:Xylt2 UTSW 11 94668209 missense probably damaging 1.00
R1702:Xylt2 UTSW 11 94668745 missense probably damaging 0.98
R1712:Xylt2 UTSW 11 94668749 missense possibly damaging 0.88
R2233:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R2234:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R4534:Xylt2 UTSW 11 94666350 missense probably benign 0.02
R4702:Xylt2 UTSW 11 94669529 missense possibly damaging 0.83
R5032:Xylt2 UTSW 11 94670016 missense probably damaging 0.99
R5237:Xylt2 UTSW 11 94667127 missense probably benign
R5281:Xylt2 UTSW 11 94668790 missense probably benign 0.30
R5949:Xylt2 UTSW 11 94668483 missense probably damaging 1.00
R6950:Xylt2 UTSW 11 94667629 missense probably benign
R7041:Xylt2 UTSW 11 94667582 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGATCTGGGCCACATCAC -3'
(R):5'- GCTCTAAGGACACAGACAGCTC -3'

Sequencing Primer
(F):5'- GGTACCCTAGTCCCTTACCAG -3'
(R):5'- TGAGAGCCCAGGTGTGC -3'
Posted On2015-12-21