Incidental Mutation 'R4769:Slc9a2'
ID366304
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40726374 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 308 (R308Q)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: R308Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: R308Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192345
AA Change: R308Q

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: R308Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAGGTCCTGTACAACTTG -3'
(R):5'- CAGCTCCACATTGCAGTAGC -3'

Sequencing Primer
(F):5'- CAGGTCCTGTACAACTTGTTCAAG -3'
(R):5'- CTTTCATTTCGGTGTAACAAAAGG -3'
Posted On2015-12-21