Mutagenetix > Incidental Mutations

Incidental Mutation 'R4769:Aox4'

366305

Institutional Source

Beutler Lab

Gene Symbol

Aox4

Ensembl Gene

ENSMUSG00000038242

Gene Name

aldehyde oxidase 4

Synonyms

2310003G12Rik, AOH2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4769 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58210397-58268597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58259148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1091 (D1091G)

Ref Sequence

ENSEMBL: ENSMUSP00000048929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040442]

AlphaFold

Q3TYQ9

Predicted Effect

probably null
Transcript: ENSMUST00000040442
AA Change: D1091G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: D1091G

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.6e-10	PFAM
Pfam:Fer2_2	91	165	4.6e-30	PFAM
Pfam:FAD_binding_5	240	421	2.7e-47	PFAM
CO_deh_flav_C	428	532	1.19e-26	SMART
Ald_Xan_dh_C	596	699	8.22e-39	SMART
Pfam:Ald_Xan_dh_C2	709	1243	1.1e-178	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161126

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161833

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	C	14: 32,660,217	S1264A	probably benign	Het
Adamts13	T	G	2: 27,008,711	Y1361*	probably null	Het
Ahrr	A	T	13: 74,214,212	D389E	probably damaging	Het
Alx3	T	C	3: 107,600,691	F172S	probably damaging	Het
Antxrl	A	G	14: 34,073,070	H485R	possibly damaging	Het
Btbd1	T	A	7: 81,805,810	Q271L	probably benign	Het
Cd209c	A	T	8: 3,944,953	N70K	probably benign	Het
Cdc14a	C	T	3: 116,294,750		probably null	Het
Cenpe	A	G	3: 135,248,151	M1641V	probably benign	Het
Clec2e	G	A	6: 129,100,827	T16I	probably benign	Het
Clp1	T	C	2: 84,725,875	D87G	possibly damaging	Het
Dpy19l1	A	T	9: 24,426,148	F517I	probably damaging	Het
Dzip3	T	C	16: 48,938,474	N646S	probably damaging	Het
Ephx1	T	A	1: 180,995,978	Y188F	possibly damaging	Het
Etfa	A	T	9: 55,495,767	H81Q	possibly damaging	Het
Gigyf2	T	A	1: 87,440,849	F1084I	probably damaging	Het
Heatr3	T	C	8: 88,141,783		probably null	Het
Ift81	G	T	5: 122,594,593	H293N	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Il6	T	G	5: 30,018,078	L114*	probably null	Het
Ism2	A	T	12: 87,299,581	M42K	probably benign	Het
Lhx5	A	G	5: 120,436,438	E269G	probably benign	Het
Marveld1	T	G	19: 42,147,995	M116R	possibly damaging	Het
Micall2	A	G	5: 139,706,886	S911P	probably damaging	Het
Mier1	G	A	4: 103,140,220	R195H	probably benign	Het
Muc2	T	A	7: 141,699,691		probably null	Het
Mybbp1a	A	G	11: 72,445,640	K486R	probably damaging	Het
Ncapd2	A	C	6: 125,185,745	L179R	probably damaging	Het
Nos1	C	T	5: 117,943,245	Q1171*	probably null	Het
Nrg1	T	A	8: 31,917,972	I78F	probably damaging	Het
Olfr1163	T	G	2: 88,070,729	T218P	probably benign	Het
Olfr220	T	G	1: 174,448,958	F112V	possibly damaging	Het
Plek2	C	T	12: 78,906,890		probably null	Het
Plod2	A	G	9: 92,595,272	H339R	probably damaging	Het
Pold1	C	T	7: 44,535,071	C835Y	probably damaging	Het
Polr1a	A	G	6: 71,950,868	I868V	probably benign	Het
Prss54	C	A	8: 95,559,375	V357L	probably benign	Het
Rbbp8	T	A	18: 11,722,670	S625T	probably damaging	Het
Rgs1	A	T	1: 144,247,929	L86Q	probably damaging	Het
Ripk4	T	A	16: 97,744,062	N462Y	probably damaging	Het
Rsf1	C	T	7: 97,676,222	L1011F	probably damaging	Het
Slc19a3	G	A	1: 83,019,341	T382I	probably damaging	Het
Slc9a2	G	A	1: 40,726,374	R308Q	probably damaging	Het
Top2b	T	A	14: 16,398,991	L537Q	probably damaging	Het
Trim45	C	A	3: 100,931,734		probably benign	Het
Umodl1	G	T	17: 30,984,002	R443M	possibly damaging	Het
Vmn1r11	G	A	6: 57,137,612	R87K	probably damaging	Het
Vmn1r78	T	A	7: 12,152,798	I112N	probably damaging	Het
Zeb2	T	G	2: 44,996,435	E825A	probably damaging	Het
Zfp930	A	T	8: 69,226,692	I50F	probably benign	Het

Other mutations in Aox4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Aox4	APN	1	58239174	missense	probably damaging	1.00
IGL01011:Aox4	APN	1	58240775	nonsense	probably null
IGL01634:Aox4	APN	1	58221930	missense	possibly damaging	0.81
IGL01689:Aox4	APN	1	58245161	splice site	probably benign
IGL01874:Aox4	APN	1	58252084	missense	probably damaging	1.00
IGL02104:Aox4	APN	1	58236657	splice site	probably benign
IGL02744:Aox4	APN	1	58255552	missense	possibly damaging	0.90
IGL02751:Aox4	APN	1	58259052	missense	probably damaging	1.00
IGL03225:Aox4	APN	1	58247227	missense	possibly damaging	0.94
IGL03247:Aox4	APN	1	58264367	missense	probably damaging	1.00
IGL03369:Aox4	APN	1	58262587	missense	probably benign	0.01
BB008:Aox4	UTSW	1	58255486	missense	probably benign	0.07
BB018:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R0138:Aox4	UTSW	1	58228866	missense	probably damaging	1.00
R0243:Aox4	UTSW	1	58213076	missense	probably benign
R0368:Aox4	UTSW	1	58213079	missense	probably benign	0.07
R0499:Aox4	UTSW	1	58263397	critical splice donor site	probably null
R0513:Aox4	UTSW	1	58217519	missense	probably benign
R0513:Aox4	UTSW	1	58247300	missense	probably damaging	1.00
R0546:Aox4	UTSW	1	58250174	missense	probably damaging	1.00
R0591:Aox4	UTSW	1	58239102	splice site	probably benign
R0825:Aox4	UTSW	1	58248909	missense	possibly damaging	0.55
R1912:Aox4	UTSW	1	58264402	missense	probably damaging	1.00
R1934:Aox4	UTSW	1	58245936	missense	probably benign	0.01
R2180:Aox4	UTSW	1	58213067	missense	probably benign	0.00
R2293:Aox4	UTSW	1	58221937	missense	probably damaging	0.99
R3017:Aox4	UTSW	1	58235204	missense	probably benign
R3744:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3745:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3830:Aox4	UTSW	1	58255511	missense	probably damaging	0.99
R3856:Aox4	UTSW	1	58253934	missense	probably damaging	1.00
R4214:Aox4	UTSW	1	58221892	missense	probably damaging	0.99
R4484:Aox4	UTSW	1	58262571	missense	probably damaging	1.00
R4706:Aox4	UTSW	1	58266787	missense	probably damaging	1.00
R4710:Aox4	UTSW	1	58255638	missense	probably damaging	1.00
R4729:Aox4	UTSW	1	58259077	nonsense	probably null
R4809:Aox4	UTSW	1	58266649	missense	probably damaging	1.00
R4989:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5082:Aox4	UTSW	1	58231483	missense	possibly damaging	0.63
R5102:Aox4	UTSW	1	58240778	missense	probably damaging	1.00
R5114:Aox4	UTSW	1	58246286	missense	possibly damaging	0.89
R5133:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5134:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5185:Aox4	UTSW	1	58254318	missense	probably damaging	1.00
R5217:Aox4	UTSW	1	58246241	nonsense	probably null
R5426:Aox4	UTSW	1	58220094	missense	probably damaging	1.00
R5443:Aox4	UTSW	1	58233992	splice site	probably null
R5708:Aox4	UTSW	1	58245873	missense	possibly damaging	0.69
R6052:Aox4	UTSW	1	58254318	nonsense	probably null
R6167:Aox4	UTSW	1	58263935	missense	probably damaging	1.00
R6179:Aox4	UTSW	1	58231503	missense	probably benign
R6196:Aox4	UTSW	1	58217526	missense	probably damaging	1.00
R6513:Aox4	UTSW	1	58213053	missense	probably benign	0.01
R6781:Aox4	UTSW	1	58245109	missense	probably benign	0.03
R6885:Aox4	UTSW	1	58264378	missense	probably damaging	1.00
R7082:Aox4	UTSW	1	58224193	missense	possibly damaging	0.82
R7127:Aox4	UTSW	1	58228874	missense	probably benign	0.00
R7153:Aox4	UTSW	1	58250219	missense	probably damaging	0.99
R7371:Aox4	UTSW	1	58263854	missense	probably damaging	1.00
R7690:Aox4	UTSW	1	58263917	missense	probably damaging	1.00
R7745:Aox4	UTSW	1	58240707	missense	probably benign	0.01
R7752:Aox4	UTSW	1	58253948	missense	not run
R7767:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7782:Aox4	UTSW	1	58231092	splice site	probably null
R7931:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R7978:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7982:Aox4	UTSW	1	58257241	missense	possibly damaging	0.81
R8316:Aox4	UTSW	1	58254311	missense	possibly damaging	0.69
R8361:Aox4	UTSW	1	58240839	missense	probably benign	0.03
R8829:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8832:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8896:Aox4	UTSW	1	58252074	missense	probably benign
R9103:Aox4	UTSW	1	58257282	missense	probably damaging	1.00
R9241:Aox4	UTSW	1	58252186	missense	probably damaging	1.00
R9282:Aox4	UTSW	1	58245869	missense	possibly damaging	0.59
X0021:Aox4	UTSW	1	58247295	nonsense	probably null
X0028:Aox4	UTSW	1	58254183	missense	probably damaging	0.99
Z1176:Aox4	UTSW	1	58246351	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TCAGGCTTCATGCTCAGTTC -3'
(R):5'- ACATGGGTTAAGGTCAGCAGC -3'

Sequencing Primer
(F):5'- CAGGCTTCATGCTCAGTTCTAGAAG -3'
(R):5'- TTAAGGTCAGCAGCCCATG -3'

Posted On

2015-12-21