Incidental Mutation 'R4769:Rgs1'
ID 366308
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Name regulator of G-protein signaling 1
Synonyms BL34
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R4769 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 144120407-144124862 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144123667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 86 (L86Q)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
AlphaFold Q9JL25
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169042
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170870
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185714
AA Change: L59Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358
AA Change: L59Q

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189061
AA Change: L86Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: L86Q

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189916
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,382,174 (GRCm39) S1264A probably benign Het
Adamts13 T G 2: 26,898,723 (GRCm39) Y1361* probably null Het
Ahrr A T 13: 74,362,331 (GRCm39) D389E probably damaging Het
Alx3 T C 3: 107,508,007 (GRCm39) F172S probably damaging Het
Antxrl A G 14: 33,795,027 (GRCm39) H485R possibly damaging Het
Aox4 A G 1: 58,298,307 (GRCm39) D1091G probably null Het
Btbd1 T A 7: 81,455,558 (GRCm39) Q271L probably benign Het
Cd209c A T 8: 3,994,953 (GRCm39) N70K probably benign Het
Cdc14a C T 3: 116,088,399 (GRCm39) probably null Het
Cenpe A G 3: 134,953,912 (GRCm39) M1641V probably benign Het
Clec2e G A 6: 129,077,790 (GRCm39) T16I probably benign Het
Clp1 T C 2: 84,556,219 (GRCm39) D87G possibly damaging Het
Dpy19l1 A T 9: 24,337,444 (GRCm39) F517I probably damaging Het
Dzip3 T C 16: 48,758,837 (GRCm39) N646S probably damaging Het
Ephx1 T A 1: 180,823,543 (GRCm39) Y188F possibly damaging Het
Etfa A T 9: 55,403,051 (GRCm39) H81Q possibly damaging Het
Gigyf2 T A 1: 87,368,571 (GRCm39) F1084I probably damaging Het
Heatr3 T C 8: 88,868,411 (GRCm39) probably null Het
Ift81 G T 5: 122,732,656 (GRCm39) H293N probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Il6 T G 5: 30,223,076 (GRCm39) L114* probably null Het
Ism2 A T 12: 87,346,355 (GRCm39) M42K probably benign Het
Lhx5 A G 5: 120,574,503 (GRCm39) E269G probably benign Het
Marveld1 T G 19: 42,136,434 (GRCm39) M116R possibly damaging Het
Micall2 A G 5: 139,692,641 (GRCm39) S911P probably damaging Het
Mier1 G A 4: 102,997,417 (GRCm39) R195H probably benign Het
Muc2 T A 7: 141,286,260 (GRCm39) probably null Het
Mybbp1a A G 11: 72,336,466 (GRCm39) K486R probably damaging Het
Ncapd2 A C 6: 125,162,708 (GRCm39) L179R probably damaging Het
Nos1 C T 5: 118,081,310 (GRCm39) Q1171* probably null Het
Nrg1 T A 8: 32,408,000 (GRCm39) I78F probably damaging Het
Or5d36 T G 2: 87,901,073 (GRCm39) T218P probably benign Het
Or6y1 T G 1: 174,276,524 (GRCm39) F112V possibly damaging Het
Plek2 C T 12: 78,953,664 (GRCm39) probably null Het
Plod2 A G 9: 92,477,325 (GRCm39) H339R probably damaging Het
Pold1 C T 7: 44,184,495 (GRCm39) C835Y probably damaging Het
Polr1a A G 6: 71,927,852 (GRCm39) I868V probably benign Het
Prss54 C A 8: 96,286,003 (GRCm39) V357L probably benign Het
Rbbp8 T A 18: 11,855,727 (GRCm39) S625T probably damaging Het
Ripk4 T A 16: 97,545,262 (GRCm39) N462Y probably damaging Het
Rsf1 C T 7: 97,325,429 (GRCm39) L1011F probably damaging Het
Slc19a3 G A 1: 82,997,062 (GRCm39) T382I probably damaging Het
Slc9a2 G A 1: 40,765,534 (GRCm39) R308Q probably damaging Het
Top2b T A 14: 16,398,991 (GRCm38) L537Q probably damaging Het
Trim45 C A 3: 100,839,050 (GRCm39) probably benign Het
Umodl1 G T 17: 31,202,976 (GRCm39) R443M possibly damaging Het
Vmn1r11 G A 6: 57,114,597 (GRCm39) R87K probably damaging Het
Vmn1r78 T A 7: 11,886,725 (GRCm39) I112N probably damaging Het
Zeb2 T G 2: 44,886,447 (GRCm39) E825A probably damaging Het
Zfp930 A T 8: 69,679,344 (GRCm39) I50F probably benign Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144,121,116 (GRCm39) missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0149:Rgs1 UTSW 1 144,124,825 (GRCm39) start gained probably benign
R0295:Rgs1 UTSW 1 144,121,224 (GRCm39) missense probably damaging 1.00
R0833:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144,121,227 (GRCm39) critical splice acceptor site probably null
R4373:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4375:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4961:Rgs1 UTSW 1 144,124,309 (GRCm39) splice site probably null
R4992:Rgs1 UTSW 1 144,122,060 (GRCm39) missense probably damaging 1.00
R5427:Rgs1 UTSW 1 144,122,018 (GRCm39) nonsense probably null
R5614:Rgs1 UTSW 1 144,121,995 (GRCm39) missense probably benign 0.18
R5743:Rgs1 UTSW 1 144,121,110 (GRCm39) missense probably damaging 1.00
R7315:Rgs1 UTSW 1 144,124,637 (GRCm39) critical splice donor site probably null
R7491:Rgs1 UTSW 1 144,121,134 (GRCm39) missense probably damaging 1.00
R7633:Rgs1 UTSW 1 144,124,215 (GRCm39) critical splice donor site probably null
R9640:Rgs1 UTSW 1 144,121,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTGGCAGATTTGTCTAAAGGAC -3'
(R):5'- GCCCATATTAGAGCCAATGAAC -3'

Sequencing Primer
(F):5'- AAGGACAGTGATAAAAATCTAGTGC -3'
(R):5'- ATGTCCACATCAGTTTTCTATTTGTG -3'
Posted On 2015-12-21