Incidental Mutation 'R4769:Ephx1'
ID366311
Institutional Source Beutler Lab
Gene Symbol Ephx1
Ensembl Gene ENSMUSG00000038776
Gene Nameepoxide hydrolase 1, microsomal
SynonymsEph-1, mEH, Eph1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180976210-181020904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180995978 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 188 (Y188F)
Ref Sequence ENSEMBL: ENSMUSP00000106697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036928] [ENSMUST00000111068] [ENSMUST00000147585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036928
AA Change: Y188F

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047551
Gene: ENSMUSG00000038776
AA Change: Y188F

DomainStartEndE-ValueType
Pfam:EHN 50 160 2.1e-36 PFAM
Pfam:Abhydrolase_1 142 404 2.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111068
AA Change: Y188F

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106697
Gene: ENSMUSG00000038776
AA Change: Y188F

DomainStartEndE-ValueType
Pfam:EHN 49 161 4.2e-38 PFAM
Pfam:Abhydrolase_6 144 430 3.7e-10 PFAM
Pfam:Abhydrolase_1 178 254 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147585
SMART Domains Protein: ENSMUSP00000122671
Gene: ENSMUSG00000038776

DomainStartEndE-ValueType
Pfam:EHN 49 130 2.6e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154133
AA Change: Y64F
SMART Domains Protein: ENSMUSP00000114363
Gene: ENSMUSG00000038776
AA Change: Y64F

DomainStartEndE-ValueType
Pfam:EHN 1 37 1.2e-8 PFAM
Pfam:Abhydrolase_1 19 247 2.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly resistant to DMBA-induced skin carcinogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Ephx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Ephx1 APN 1 180999821 missense possibly damaging 0.82
IGL00864:Ephx1 APN 1 180990451 missense probably damaging 1.00
IGL00972:Ephx1 APN 1 180999800 missense probably benign 0.02
IGL01577:Ephx1 APN 1 181001980 start codon destroyed probably null 0.96
IGL02718:Ephx1 APN 1 180999786 missense probably damaging 1.00
IGL03330:Ephx1 APN 1 180999806 missense possibly damaging 0.53
R1190:Ephx1 UTSW 1 180993929 missense probably benign 0.24
R1751:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R1767:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R2437:Ephx1 UTSW 1 180996096 missense probably damaging 1.00
R2484:Ephx1 UTSW 1 180989972 missense probably damaging 1.00
R3623:Ephx1 UTSW 1 180989933 missense probably benign 0.35
R3696:Ephx1 UTSW 1 180989951 missense probably benign 0.03
R4674:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4675:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4883:Ephx1 UTSW 1 181001923 missense possibly damaging 0.76
R6827:Ephx1 UTSW 1 180989888 missense probably damaging 1.00
R6974:Ephx1 UTSW 1 180999722 critical splice donor site probably null
R7147:Ephx1 UTSW 1 181001819 missense probably damaging 0.96
R7847:Ephx1 UTSW 1 181001861 missense probably benign 0.00
Z1177:Ephx1 UTSW 1 180999769 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGGTGCCCTAAAGAAGACC -3'
(R):5'- GCTGGACATCCACTTCATCC -3'

Sequencing Primer
(F):5'- CAGATCACAGTGCAATGAGCCTG -3'
(R):5'- GGACATCCACTTCATCCACGTG -3'
Posted On2015-12-21