Mutagenetix > Incidental Mutation

Incidental Mutation 'R4769:Cenpe'

366320

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4769 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135248151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1641 (M1641V)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062893
AA Change: M1641V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: M1641V

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197369

SMART Domains

Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
coiled coil region	2	49	N/A	INTRINSIC
coiled coil region	85	172	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	C	14: 32,660,217	S1264A	probably benign	Het
Adamts13	T	G	2: 27,008,711	Y1361*	probably null	Het
Ahrr	A	T	13: 74,214,212	D389E	probably damaging	Het
Alx3	T	C	3: 107,600,691	F172S	probably damaging	Het
Antxrl	A	G	14: 34,073,070	H485R	possibly damaging	Het
Aox4	A	G	1: 58,259,148	D1091G	probably null	Het
Btbd1	T	A	7: 81,805,810	Q271L	probably benign	Het
Cd209c	A	T	8: 3,944,953	N70K	probably benign	Het
Cdc14a	C	T	3: 116,294,750		probably null	Het
Clec2e	G	A	6: 129,100,827	T16I	probably benign	Het
Clp1	T	C	2: 84,725,875	D87G	possibly damaging	Het
Dpy19l1	A	T	9: 24,426,148	F517I	probably damaging	Het
Dzip3	T	C	16: 48,938,474	N646S	probably damaging	Het
Ephx1	T	A	1: 180,995,978	Y188F	possibly damaging	Het
Etfa	A	T	9: 55,495,767	H81Q	possibly damaging	Het
Gigyf2	T	A	1: 87,440,849	F1084I	probably damaging	Het
Heatr3	T	C	8: 88,141,783		probably null	Het
Ift81	G	T	5: 122,594,593	H293N	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Il6	T	G	5: 30,018,078	L114*	probably null	Het
Ism2	A	T	12: 87,299,581	M42K	probably benign	Het
Lhx5	A	G	5: 120,436,438	E269G	probably benign	Het
Marveld1	T	G	19: 42,147,995	M116R	possibly damaging	Het
Micall2	A	G	5: 139,706,886	S911P	probably damaging	Het
Mier1	G	A	4: 103,140,220	R195H	probably benign	Het
Muc2	T	A	7: 141,699,691		probably null	Het
Mybbp1a	A	G	11: 72,445,640	K486R	probably damaging	Het
Ncapd2	A	C	6: 125,185,745	L179R	probably damaging	Het
Nos1	C	T	5: 117,943,245	Q1171*	probably null	Het
Nrg1	T	A	8: 31,917,972	I78F	probably damaging	Het
Olfr1163	T	G	2: 88,070,729	T218P	probably benign	Het
Olfr220	T	G	1: 174,448,958	F112V	possibly damaging	Het
Plek2	C	T	12: 78,906,890		probably null	Het
Plod2	A	G	9: 92,595,272	H339R	probably damaging	Het
Pold1	C	T	7: 44,535,071	C835Y	probably damaging	Het
Polr1a	A	G	6: 71,950,868	I868V	probably benign	Het
Prss54	C	A	8: 95,559,375	V357L	probably benign	Het
Rbbp8	T	A	18: 11,722,670	S625T	probably damaging	Het
Rgs1	A	T	1: 144,247,929	L86Q	probably damaging	Het
Ripk4	T	A	16: 97,744,062	N462Y	probably damaging	Het
Rsf1	C	T	7: 97,676,222	L1011F	probably damaging	Het
Slc19a3	G	A	1: 83,019,341	T382I	probably damaging	Het
Slc9a2	G	A	1: 40,726,374	R308Q	probably damaging	Het
Top2b	T	A	14: 16,398,991	L537Q	probably damaging	Het
Trim45	C	A	3: 100,931,734		probably benign	Het
Umodl1	G	T	17: 30,984,002	R443M	possibly damaging	Het
Vmn1r11	G	A	6: 57,137,612	R87K	probably damaging	Het
Vmn1r78	T	A	7: 12,152,798	I112N	probably damaging	Het
Zeb2	T	G	2: 44,996,435	E825A	probably damaging	Het
Zfp930	A	T	8: 69,226,692	I50F	probably benign	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GTGGTCACATCTAAAGCAACTC -3'
(R):5'- TTAGAGTGTTGGACAAACGGAC -3'

Sequencing Primer
(F):5'- GGTCACATCTAAAGCAACTCAAGGG -3'
(R):5'- ACACGTGAGCCTTCAGAT -3'

Posted On

2015-12-21