Incidental Mutation 'R4769:Il6'
ID 366322
Institutional Source Beutler Lab
Gene Symbol Il6
Ensembl Gene ENSMUSG00000025746
Gene Name interleukin 6
Synonyms Il-6
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R4769 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 30218112-30224973 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 30223076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 114 (L114*)
Ref Sequence ENSEMBL: ENSMUSP00000143157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026845] [ENSMUST00000195978] [ENSMUST00000199183] [ENSMUST00000199765]
AlphaFold P08505
Predicted Effect probably null
Transcript: ENSMUST00000026845
AA Change: L131*
SMART Domains Protein: ENSMUSP00000026845
Gene: ENSMUSG00000025746
AA Change: L131*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 209 2.1e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195978
AA Change: L131*
SMART Domains Protein: ENSMUSP00000143544
Gene: ENSMUSG00000025746
AA Change: L131*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 162 5.8e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199183
AA Change: L131*
SMART Domains Protein: ENSMUSP00000143293
Gene: ENSMUSG00000025746
AA Change: L131*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 175 3.9e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199765
AA Change: L114*
SMART Domains Protein: ENSMUSP00000143157
Gene: ENSMUSG00000025746
AA Change: L114*

DomainStartEndE-ValueType
IL6 38 192 2.1e-98 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show impaired immune response to pathogens, decreased T cell numbers and resistance to plasma cell neoplasia. They are defective in wound healing and liver regeneration and show increased emotionality and high bone turnover rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,382,174 (GRCm39) S1264A probably benign Het
Adamts13 T G 2: 26,898,723 (GRCm39) Y1361* probably null Het
Ahrr A T 13: 74,362,331 (GRCm39) D389E probably damaging Het
Alx3 T C 3: 107,508,007 (GRCm39) F172S probably damaging Het
Antxrl A G 14: 33,795,027 (GRCm39) H485R possibly damaging Het
Aox4 A G 1: 58,298,307 (GRCm39) D1091G probably null Het
Btbd1 T A 7: 81,455,558 (GRCm39) Q271L probably benign Het
Cd209c A T 8: 3,994,953 (GRCm39) N70K probably benign Het
Cdc14a C T 3: 116,088,399 (GRCm39) probably null Het
Cenpe A G 3: 134,953,912 (GRCm39) M1641V probably benign Het
Clec2e G A 6: 129,077,790 (GRCm39) T16I probably benign Het
Clp1 T C 2: 84,556,219 (GRCm39) D87G possibly damaging Het
Dpy19l1 A T 9: 24,337,444 (GRCm39) F517I probably damaging Het
Dzip3 T C 16: 48,758,837 (GRCm39) N646S probably damaging Het
Ephx1 T A 1: 180,823,543 (GRCm39) Y188F possibly damaging Het
Etfa A T 9: 55,403,051 (GRCm39) H81Q possibly damaging Het
Gigyf2 T A 1: 87,368,571 (GRCm39) F1084I probably damaging Het
Heatr3 T C 8: 88,868,411 (GRCm39) probably null Het
Ift81 G T 5: 122,732,656 (GRCm39) H293N probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ism2 A T 12: 87,346,355 (GRCm39) M42K probably benign Het
Lhx5 A G 5: 120,574,503 (GRCm39) E269G probably benign Het
Marveld1 T G 19: 42,136,434 (GRCm39) M116R possibly damaging Het
Micall2 A G 5: 139,692,641 (GRCm39) S911P probably damaging Het
Mier1 G A 4: 102,997,417 (GRCm39) R195H probably benign Het
Muc2 T A 7: 141,286,260 (GRCm39) probably null Het
Mybbp1a A G 11: 72,336,466 (GRCm39) K486R probably damaging Het
Ncapd2 A C 6: 125,162,708 (GRCm39) L179R probably damaging Het
Nos1 C T 5: 118,081,310 (GRCm39) Q1171* probably null Het
Nrg1 T A 8: 32,408,000 (GRCm39) I78F probably damaging Het
Or5d36 T G 2: 87,901,073 (GRCm39) T218P probably benign Het
Or6y1 T G 1: 174,276,524 (GRCm39) F112V possibly damaging Het
Plek2 C T 12: 78,953,664 (GRCm39) probably null Het
Plod2 A G 9: 92,477,325 (GRCm39) H339R probably damaging Het
Pold1 C T 7: 44,184,495 (GRCm39) C835Y probably damaging Het
Polr1a A G 6: 71,927,852 (GRCm39) I868V probably benign Het
Prss54 C A 8: 96,286,003 (GRCm39) V357L probably benign Het
Rbbp8 T A 18: 11,855,727 (GRCm39) S625T probably damaging Het
Rgs1 A T 1: 144,123,667 (GRCm39) L86Q probably damaging Het
Ripk4 T A 16: 97,545,262 (GRCm39) N462Y probably damaging Het
Rsf1 C T 7: 97,325,429 (GRCm39) L1011F probably damaging Het
Slc19a3 G A 1: 82,997,062 (GRCm39) T382I probably damaging Het
Slc9a2 G A 1: 40,765,534 (GRCm39) R308Q probably damaging Het
Top2b T A 14: 16,398,991 (GRCm38) L537Q probably damaging Het
Trim45 C A 3: 100,839,050 (GRCm39) probably benign Het
Umodl1 G T 17: 31,202,976 (GRCm39) R443M possibly damaging Het
Vmn1r11 G A 6: 57,114,597 (GRCm39) R87K probably damaging Het
Vmn1r78 T A 7: 11,886,725 (GRCm39) I112N probably damaging Het
Zeb2 T G 2: 44,886,447 (GRCm39) E825A probably damaging Het
Zfp930 A T 8: 69,679,344 (GRCm39) I50F probably benign Het
Other mutations in Il6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Il6 APN 5 30,219,839 (GRCm39) missense probably benign 0.06
IGL01085:Il6 APN 5 30,218,487 (GRCm39) missense probably damaging 0.98
IGL01549:Il6 APN 5 30,224,469 (GRCm39) missense probably benign 0.01
R1510:Il6 UTSW 5 30,223,060 (GRCm39) missense probably damaging 0.96
R1721:Il6 UTSW 5 30,218,490 (GRCm39) missense possibly damaging 0.90
R1774:Il6 UTSW 5 30,224,433 (GRCm39) missense probably benign
R2018:Il6 UTSW 5 30,219,945 (GRCm39) critical splice donor site probably null
R2153:Il6 UTSW 5 30,218,502 (GRCm39) nonsense probably null
R2344:Il6 UTSW 5 30,219,854 (GRCm39) missense probably benign 0.00
R3889:Il6 UTSW 5 30,223,066 (GRCm39) missense possibly damaging 0.57
R4743:Il6 UTSW 5 30,223,042 (GRCm39) missense probably damaging 0.96
R4965:Il6 UTSW 5 30,218,491 (GRCm39) missense possibly damaging 0.53
R5024:Il6 UTSW 5 30,224,512 (GRCm39) missense probably damaging 1.00
R5817:Il6 UTSW 5 30,223,006 (GRCm39) missense probably benign
R5858:Il6 UTSW 5 30,218,472 (GRCm39) missense possibly damaging 0.67
R6886:Il6 UTSW 5 30,223,201 (GRCm39) intron probably benign
R7254:Il6 UTSW 5 30,219,906 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CACCAGAGGTTCTTTTATTGTTGAG -3'
(R):5'- GCAAGGCCTTATAATCAAGAACTG -3'

Sequencing Primer
(F):5'- CCTAGAAAGAACTGACTTCCT -3'
(R):5'- AACTGTTGTTCAGACTCTCTCC -3'
Posted On 2015-12-21