Incidental Mutation 'R4769:Il6'
ID366322
Institutional Source Beutler Lab
Gene Symbol Il6
Ensembl Gene ENSMUSG00000025746
Gene Nameinterleukin 6
SynonymsIl-6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30013114-30019981 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 30018078 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 114 (L114*)
Ref Sequence ENSEMBL: ENSMUSP00000143157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026845] [ENSMUST00000195978] [ENSMUST00000199183] [ENSMUST00000199765]
Predicted Effect probably null
Transcript: ENSMUST00000026845
AA Change: L131*
SMART Domains Protein: ENSMUSP00000026845
Gene: ENSMUSG00000025746
AA Change: L131*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 209 2.1e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195978
AA Change: L131*
SMART Domains Protein: ENSMUSP00000143544
Gene: ENSMUSG00000025746
AA Change: L131*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 162 5.8e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199183
AA Change: L131*
SMART Domains Protein: ENSMUSP00000143293
Gene: ENSMUSG00000025746
AA Change: L131*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 175 3.9e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199765
AA Change: L114*
SMART Domains Protein: ENSMUSP00000143157
Gene: ENSMUSG00000025746
AA Change: L114*

DomainStartEndE-ValueType
IL6 38 192 2.1e-98 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show impaired immune response to pathogens, decreased T cell numbers and resistance to plasma cell neoplasia. They are defective in wound healing and liver regeneration and show increased emotionality and high bone turnover rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Il6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Il6 APN 5 30014841 missense probably benign 0.06
IGL01085:Il6 APN 5 30013489 missense probably damaging 0.98
IGL01549:Il6 APN 5 30019471 missense probably benign 0.01
R1510:Il6 UTSW 5 30018062 missense probably damaging 0.96
R1721:Il6 UTSW 5 30013492 missense possibly damaging 0.90
R1774:Il6 UTSW 5 30019435 missense probably benign
R2018:Il6 UTSW 5 30014947 critical splice donor site probably null
R2153:Il6 UTSW 5 30013504 nonsense probably null
R2344:Il6 UTSW 5 30014856 missense probably benign 0.00
R3889:Il6 UTSW 5 30018068 missense possibly damaging 0.57
R4743:Il6 UTSW 5 30018044 missense probably damaging 0.96
R4965:Il6 UTSW 5 30013493 missense possibly damaging 0.53
R5024:Il6 UTSW 5 30019514 missense probably damaging 1.00
R5817:Il6 UTSW 5 30018008 missense probably benign
R5858:Il6 UTSW 5 30013474 missense possibly damaging 0.67
R6886:Il6 UTSW 5 30018203 intron probably benign
R7254:Il6 UTSW 5 30014908 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CACCAGAGGTTCTTTTATTGTTGAG -3'
(R):5'- GCAAGGCCTTATAATCAAGAACTG -3'

Sequencing Primer
(F):5'- CCTAGAAAGAACTGACTTCCT -3'
(R):5'- AACTGTTGTTCAGACTCTCTCC -3'
Posted On2015-12-21