Incidental Mutation 'R4769:Ift81'
ID 366325
Institutional Source Beutler Lab
Gene Symbol Ift81
Ensembl Gene ENSMUSG00000029469
Gene Name intraflagellar transport 81
Synonyms CDV-1R, Cdv1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4769 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 122550204-122614518 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 122594593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 293 (H293N)
Ref Sequence ENSEMBL: ENSMUSP00000031426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031426]
AlphaFold O35594
Predicted Effect probably benign
Transcript: ENSMUST00000031426
AA Change: H293N

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031426
Gene: ENSMUSG00000029469
AA Change: H293N

DomainStartEndE-ValueType
PDB:4LVP|A 5 128 2e-23 PDB
coiled coil region 167 258 N/A INTRINSIC
coiled coil region 308 383 N/A INTRINSIC
coiled coil region 503 591 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139590
AA Change: H137N
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with IFT74, forms a tubulin-binding module of intraflagellar transport complex B. This module is involved in transport of tubulin within the cilium, and the encoded protein is required for ciliogenesis. Mutations in this gene are a cause of short-rib polydactyly syndromes. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Ift81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Ift81 APN 5 122610968 missense probably damaging 1.00
IGL01867:Ift81 APN 5 122602676 splice site probably benign
IGL01927:Ift81 APN 5 122593129 missense probably benign 0.25
IGL02954:Ift81 APN 5 122610185 splice site probably benign
IGL03003:Ift81 APN 5 122594662 missense probably benign 0.01
R1179:Ift81 UTSW 5 122602710 missense probably benign 0.22
R1394:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1395:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1962:Ift81 UTSW 5 122560709 missense probably benign 0.01
R2084:Ift81 UTSW 5 122567347 missense probably benign 0.00
R4019:Ift81 UTSW 5 122593129 missense probably benign 0.25
R4849:Ift81 UTSW 5 122591219 missense probably damaging 1.00
R4905:Ift81 UTSW 5 122591079 critical splice donor site probably null
R4924:Ift81 UTSW 5 122594616 missense possibly damaging 0.86
R5110:Ift81 UTSW 5 122551058 missense probably benign 0.02
R5299:Ift81 UTSW 5 122607056 missense probably damaging 0.99
R5387:Ift81 UTSW 5 122555535 missense probably damaging 1.00
R6190:Ift81 UTSW 5 122551100 missense probably benign 0.00
R6241:Ift81 UTSW 5 122602351 missense probably benign 0.38
R6404:Ift81 UTSW 5 122611006 missense probably damaging 1.00
R6647:Ift81 UTSW 5 122610166 nonsense probably null
R7155:Ift81 UTSW 5 122568999 missense probably damaging 0.99
R7170:Ift81 UTSW 5 122555533 nonsense probably null
R7699:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7700:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7709:Ift81 UTSW 5 122609331 missense probably damaging 1.00
R7756:Ift81 UTSW 5 122551025 missense probably damaging 1.00
R7758:Ift81 UTSW 5 122551025 missense probably damaging 1.00
R9154:Ift81 UTSW 5 122551059 missense probably benign 0.04
R9329:Ift81 UTSW 5 122559770 critical splice acceptor site probably null
R9761:Ift81 UTSW 5 122591083 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TATCAACCCTTAGCCCAGGC -3'
(R):5'- CTGTATAGATGCTGCACAGAGAGC -3'

Sequencing Primer
(F):5'- CAGGCTAGCTCTAGAGTCACAAG -3'
(R):5'- TGCTGCACAGAGAGCTTTAAC -3'
Posted On 2015-12-21