Mutagenetix > Incidental Mutation

Incidental Mutation 'R4769:Micall2'

366326

Institutional Source

Beutler Lab

Gene Symbol

Micall2

Ensembl Gene

ENSMUSG00000036718

Gene Name

MICAL-like 2

Synonyms

A930021H16Rik, Jrab, MICAL-L2

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.292) question?

Stock #

R4769 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

139706696-139736336 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139706886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 911 (S911P)

Ref Sequence

ENSEMBL: ENSMUSP00000127937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]

AlphaFold

Q3TN34

Predicted Effect

unknown
Transcript: ENSMUST00000044642
AA Change: S994P

SMART Domains

Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718
AA Change: S994P

Domain	Start	End	E-Value	Type
CH	3	102	4.34e-20	SMART
LIM	187	241	1.62e-5	SMART
low complexity region	242	253	N/A	INTRINSIC
low complexity region	326	344	N/A	INTRINSIC
low complexity region	428	489	N/A	INTRINSIC
low complexity region	502	518	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	755	770	N/A	INTRINSIC
DUF3585	840	980	3.1e-63	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164584

Predicted Effect

probably benign
Transcript: ENSMUST00000165645

Predicted Effect

probably damaging
Transcript: ENSMUST00000170773
AA Change: S911P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718
AA Change: S911P

Domain	Start	End	E-Value	Type
SCOP:d1bkra_	1	25	9e-5	SMART
Blast:DUF3585	1	45	2e-7	BLAST
LIM	104	158	1.62e-5	SMART
low complexity region	159	170	N/A	INTRINSIC
low complexity region	243	261	N/A	INTRINSIC
low complexity region	345	406	N/A	INTRINSIC
low complexity region	419	435	N/A	INTRINSIC
low complexity region	645	663	N/A	INTRINSIC
low complexity region	672	687	N/A	INTRINSIC
DUF3585	757	897	3.1e-63	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198319

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	C	14: 32,660,217	S1264A	probably benign	Het
Adamts13	T	G	2: 27,008,711	Y1361*	probably null	Het
Ahrr	A	T	13: 74,214,212	D389E	probably damaging	Het
Alx3	T	C	3: 107,600,691	F172S	probably damaging	Het
Antxrl	A	G	14: 34,073,070	H485R	possibly damaging	Het
Aox4	A	G	1: 58,259,148	D1091G	probably null	Het
Btbd1	T	A	7: 81,805,810	Q271L	probably benign	Het
Cd209c	A	T	8: 3,944,953	N70K	probably benign	Het
Cdc14a	C	T	3: 116,294,750		probably null	Het
Cenpe	A	G	3: 135,248,151	M1641V	probably benign	Het
Clec2e	G	A	6: 129,100,827	T16I	probably benign	Het
Clp1	T	C	2: 84,725,875	D87G	possibly damaging	Het
Dpy19l1	A	T	9: 24,426,148	F517I	probably damaging	Het
Dzip3	T	C	16: 48,938,474	N646S	probably damaging	Het
Ephx1	T	A	1: 180,995,978	Y188F	possibly damaging	Het
Etfa	A	T	9: 55,495,767	H81Q	possibly damaging	Het
Gigyf2	T	A	1: 87,440,849	F1084I	probably damaging	Het
Heatr3	T	C	8: 88,141,783		probably null	Het
Ift81	G	T	5: 122,594,593	H293N	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Il6	T	G	5: 30,018,078	L114*	probably null	Het
Ism2	A	T	12: 87,299,581	M42K	probably benign	Het
Lhx5	A	G	5: 120,436,438	E269G	probably benign	Het
Marveld1	T	G	19: 42,147,995	M116R	possibly damaging	Het
Mier1	G	A	4: 103,140,220	R195H	probably benign	Het
Muc2	T	A	7: 141,699,691		probably null	Het
Mybbp1a	A	G	11: 72,445,640	K486R	probably damaging	Het
Ncapd2	A	C	6: 125,185,745	L179R	probably damaging	Het
Nos1	C	T	5: 117,943,245	Q1171*	probably null	Het
Nrg1	T	A	8: 31,917,972	I78F	probably damaging	Het
Olfr1163	T	G	2: 88,070,729	T218P	probably benign	Het
Olfr220	T	G	1: 174,448,958	F112V	possibly damaging	Het
Plek2	C	T	12: 78,906,890		probably null	Het
Plod2	A	G	9: 92,595,272	H339R	probably damaging	Het
Pold1	C	T	7: 44,535,071	C835Y	probably damaging	Het
Polr1a	A	G	6: 71,950,868	I868V	probably benign	Het
Prss54	C	A	8: 95,559,375	V357L	probably benign	Het
Rbbp8	T	A	18: 11,722,670	S625T	probably damaging	Het
Rgs1	A	T	1: 144,247,929	L86Q	probably damaging	Het
Ripk4	T	A	16: 97,744,062	N462Y	probably damaging	Het
Rsf1	C	T	7: 97,676,222	L1011F	probably damaging	Het
Slc19a3	G	A	1: 83,019,341	T382I	probably damaging	Het
Slc9a2	G	A	1: 40,726,374	R308Q	probably damaging	Het
Top2b	T	A	14: 16,398,991	L537Q	probably damaging	Het
Trim45	C	A	3: 100,931,734		probably benign	Het
Umodl1	G	T	17: 30,984,002	R443M	possibly damaging	Het
Vmn1r11	G	A	6: 57,137,612	R87K	probably damaging	Het
Vmn1r78	T	A	7: 12,152,798	I112N	probably damaging	Het
Zeb2	T	G	2: 44,996,435	E825A	probably damaging	Het
Zfp930	A	T	8: 69,226,692	I50F	probably benign	Het

Other mutations in Micall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Micall2	APN	5	139717556	critical splice acceptor site	probably null
IGL00496:Micall2	APN	5	139716328	missense	probably benign	0.01
IGL02641:Micall2	APN	5	139719339	missense	probably damaging	1.00
IGL03245:Micall2	APN	5	139719259	missense	probably damaging	1.00
IGL03252:Micall2	APN	5	139716726	missense	probably benign	0.01
R1214:Micall2	UTSW	5	139711641	missense	probably damaging	0.97
R1468:Micall2	UTSW	5	139719342	missense	probably damaging	1.00
R1468:Micall2	UTSW	5	139719342	missense	probably damaging	1.00
R1831:Micall2	UTSW	5	139716753	missense	probably benign	0.09
R1833:Micall2	UTSW	5	139716753	missense	probably benign	0.09
R1969:Micall2	UTSW	5	139736130	missense	probably damaging	1.00
R2023:Micall2	UTSW	5	139717511	missense	possibly damaging	0.51
R2060:Micall2	UTSW	5	139711562	missense	probably damaging	0.98
R2330:Micall2	UTSW	5	139717515	missense	probably damaging	1.00
R3820:Micall2	UTSW	5	139715856	missense	possibly damaging	0.92
R4299:Micall2	UTSW	5	139709471	intron	probably benign
R4334:Micall2	UTSW	5	139713350	missense	probably damaging	1.00
R4451:Micall2	UTSW	5	139707097	missense	probably damaging	1.00
R4911:Micall2	UTSW	5	139716825	missense	probably damaging	1.00
R4996:Micall2	UTSW	5	139710589	missense	probably benign	0.31
R5118:Micall2	UTSW	5	139716447	missense	probably damaging	1.00
R5155:Micall2	UTSW	5	139710231	missense	probably damaging	1.00
R5475:Micall2	UTSW	5	139716469	missense	probably damaging	1.00
R5750:Micall2	UTSW	5	139715701	splice site	probably null
R5998:Micall2	UTSW	5	139706911	critical splice acceptor site	probably null
R6181:Micall2	UTSW	5	139716751	missense	probably benign	0.41
R6852:Micall2	UTSW	5	139715793	missense	possibly damaging	0.90
R7046:Micall2	UTSW	5	139708944	unclassified	probably benign
R7395:Micall2	UTSW	5	139716369	missense	possibly damaging	0.78
R8514:Micall2	UTSW	5	139716222	missense	probably damaging	1.00
R8889:Micall2	UTSW	5	139717499	missense	probably damaging	0.98
R8892:Micall2	UTSW	5	139717499	missense	probably damaging	0.98
R8960:Micall2	UTSW	5	139716270	missense	probably benign	0.23
R9060:Micall2	UTSW	5	139719280	missense	probably damaging	1.00
R9209:Micall2	UTSW	5	139710415	missense	unknown
R9227:Micall2	UTSW	5	139716072	missense	unknown
R9230:Micall2	UTSW	5	139716072	missense	unknown
R9260:Micall2	UTSW	5	139709698	missense	unknown
R9452:Micall2	UTSW	5	139717556	critical splice acceptor site	probably null
Z1088:Micall2	UTSW	5	139706894	missense	probably damaging	1.00
Z1088:Micall2	UTSW	5	139716295	missense	probably benign	0.12
Z1177:Micall2	UTSW	5	139710302	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TATTGAGGTGACGAGGACCCAG -3'
(R):5'- TGATCCCTGTAGCTCTCCAG -3'

Sequencing Primer
(F):5'- TGACGAGGACCCAGAGTGG -3'
(R):5'- ACCTGGGTAATTATGGGGCACAATC -3'

Posted On

2015-12-21