Incidental Mutation 'R4769:Btbd1'
ID 366334
Institutional Source Beutler Lab
Gene Symbol Btbd1
Ensembl Gene ENSMUSG00000025103
Gene Name BTB domain containing 1
Synonyms 1190005H08Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R4769 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 81441822-81479179 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81455558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 271 (Q271L)
Ref Sequence ENSEMBL: ENSMUSP00000026093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026093]
AlphaFold P58544
Predicted Effect probably benign
Transcript: ENSMUST00000026093
AA Change: Q271L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026093
Gene: ENSMUSG00000025103
AA Change: Q271L

DomainStartEndE-ValueType
low complexity region 5 45 N/A INTRINSIC
BTB 75 181 2.73e-22 SMART
BACK 186 294 8.02e-10 SMART
Pfam:PHR 339 487 2.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208566
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,382,174 (GRCm39) S1264A probably benign Het
Adamts13 T G 2: 26,898,723 (GRCm39) Y1361* probably null Het
Ahrr A T 13: 74,362,331 (GRCm39) D389E probably damaging Het
Alx3 T C 3: 107,508,007 (GRCm39) F172S probably damaging Het
Antxrl A G 14: 33,795,027 (GRCm39) H485R possibly damaging Het
Aox4 A G 1: 58,298,307 (GRCm39) D1091G probably null Het
Cd209c A T 8: 3,994,953 (GRCm39) N70K probably benign Het
Cdc14a C T 3: 116,088,399 (GRCm39) probably null Het
Cenpe A G 3: 134,953,912 (GRCm39) M1641V probably benign Het
Clec2e G A 6: 129,077,790 (GRCm39) T16I probably benign Het
Clp1 T C 2: 84,556,219 (GRCm39) D87G possibly damaging Het
Dpy19l1 A T 9: 24,337,444 (GRCm39) F517I probably damaging Het
Dzip3 T C 16: 48,758,837 (GRCm39) N646S probably damaging Het
Ephx1 T A 1: 180,823,543 (GRCm39) Y188F possibly damaging Het
Etfa A T 9: 55,403,051 (GRCm39) H81Q possibly damaging Het
Gigyf2 T A 1: 87,368,571 (GRCm39) F1084I probably damaging Het
Heatr3 T C 8: 88,868,411 (GRCm39) probably null Het
Ift81 G T 5: 122,732,656 (GRCm39) H293N probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Il6 T G 5: 30,223,076 (GRCm39) L114* probably null Het
Ism2 A T 12: 87,346,355 (GRCm39) M42K probably benign Het
Lhx5 A G 5: 120,574,503 (GRCm39) E269G probably benign Het
Marveld1 T G 19: 42,136,434 (GRCm39) M116R possibly damaging Het
Micall2 A G 5: 139,692,641 (GRCm39) S911P probably damaging Het
Mier1 G A 4: 102,997,417 (GRCm39) R195H probably benign Het
Muc2 T A 7: 141,286,260 (GRCm39) probably null Het
Mybbp1a A G 11: 72,336,466 (GRCm39) K486R probably damaging Het
Ncapd2 A C 6: 125,162,708 (GRCm39) L179R probably damaging Het
Nos1 C T 5: 118,081,310 (GRCm39) Q1171* probably null Het
Nrg1 T A 8: 32,408,000 (GRCm39) I78F probably damaging Het
Or5d36 T G 2: 87,901,073 (GRCm39) T218P probably benign Het
Or6y1 T G 1: 174,276,524 (GRCm39) F112V possibly damaging Het
Plek2 C T 12: 78,953,664 (GRCm39) probably null Het
Plod2 A G 9: 92,477,325 (GRCm39) H339R probably damaging Het
Pold1 C T 7: 44,184,495 (GRCm39) C835Y probably damaging Het
Polr1a A G 6: 71,927,852 (GRCm39) I868V probably benign Het
Prss54 C A 8: 96,286,003 (GRCm39) V357L probably benign Het
Rbbp8 T A 18: 11,855,727 (GRCm39) S625T probably damaging Het
Rgs1 A T 1: 144,123,667 (GRCm39) L86Q probably damaging Het
Ripk4 T A 16: 97,545,262 (GRCm39) N462Y probably damaging Het
Rsf1 C T 7: 97,325,429 (GRCm39) L1011F probably damaging Het
Slc19a3 G A 1: 82,997,062 (GRCm39) T382I probably damaging Het
Slc9a2 G A 1: 40,765,534 (GRCm39) R308Q probably damaging Het
Top2b T A 14: 16,398,991 (GRCm38) L537Q probably damaging Het
Trim45 C A 3: 100,839,050 (GRCm39) probably benign Het
Umodl1 G T 17: 31,202,976 (GRCm39) R443M possibly damaging Het
Vmn1r11 G A 6: 57,114,597 (GRCm39) R87K probably damaging Het
Vmn1r78 T A 7: 11,886,725 (GRCm39) I112N probably damaging Het
Zeb2 T G 2: 44,886,447 (GRCm39) E825A probably damaging Het
Zfp930 A T 8: 69,679,344 (GRCm39) I50F probably benign Het
Other mutations in Btbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Btbd1 APN 7 81,444,055 (GRCm39) splice site probably null
IGL01476:Btbd1 APN 7 81,450,797 (GRCm39) nonsense probably null
IGL02261:Btbd1 APN 7 81,455,507 (GRCm39) missense probably damaging 0.98
R0164:Btbd1 UTSW 7 81,450,751 (GRCm39) missense probably benign 0.28
R0164:Btbd1 UTSW 7 81,450,751 (GRCm39) missense probably benign 0.28
R0600:Btbd1 UTSW 7 81,465,754 (GRCm39) missense probably damaging 1.00
R1221:Btbd1 UTSW 7 81,468,005 (GRCm39) missense possibly damaging 0.79
R2159:Btbd1 UTSW 7 81,450,804 (GRCm39) missense possibly damaging 0.94
R3961:Btbd1 UTSW 7 81,468,083 (GRCm39) nonsense probably null
R7159:Btbd1 UTSW 7 81,467,957 (GRCm39) missense probably benign 0.44
R7331:Btbd1 UTSW 7 81,465,720 (GRCm39) missense probably damaging 1.00
R9197:Btbd1 UTSW 7 81,443,363 (GRCm39) missense probably damaging 1.00
R9310:Btbd1 UTSW 7 81,478,985 (GRCm39) missense probably damaging 1.00
R9522:Btbd1 UTSW 7 81,479,081 (GRCm39) missense unknown
R9686:Btbd1 UTSW 7 81,455,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATGTTATCTTGAACAGCTC -3'
(R):5'- CAGAGGATGCTGCTAATCCACC -3'

Sequencing Primer
(F):5'- TGTTATCTTGAACAGCTCTTTTGAG -3'
(R):5'- AGGATGCTGCTAATCCACCATTTTAC -3'
Posted On 2015-12-21