Mutagenetix > Incidental Mutation

Incidental Mutation 'R4769:Nrg1'

366338

Institutional Source

Beutler Lab

Gene Symbol

Nrg1

Ensembl Gene

ENSMUSG00000062991

Gene Name

neuregulin 1

Synonyms

D230005F13Rik, Hgl, GGF, HRGalpha, ARIA, 6030402G23Rik, HRG, GGFII, HGL, NDF, SMDF, heregulin

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4769 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31814551-32884029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31917972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 78 (I78F)

Ref Sequence

ENSEMBL: ENSMUSP00000073546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073884] [ENSMUST00000207417] [ENSMUST00000207470] [ENSMUST00000208205] [ENSMUST00000208488] [ENSMUST00000208497] [ENSMUST00000208598] [ENSMUST00000208617] [ENSMUST00000209107] [ENSMUST00000208931] [ENSMUST00000209022] [ENSMUST00000208819]

AlphaFold

A0A140LHZ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000073884
AA Change: I78F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073546
Gene: ENSMUSG00000062991
AA Change: I78F

Domain	Start	End	E-Value	Type
transmembrane domain	78	100	N/A	INTRINSIC
low complexity region	180	198	N/A	INTRINSIC
low complexity region	223	232	N/A	INTRINSIC
EGF	236	277	7.88e-4	SMART
Pfam:Neuregulin	295	688	5.3e-193	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207417

Predicted Effect

probably benign
Transcript: ENSMUST00000207470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207678

Predicted Effect

probably benign
Transcript: ENSMUST00000208205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208206

Predicted Effect

probably benign
Transcript: ENSMUST00000208335

Predicted Effect

probably benign
Transcript: ENSMUST00000208488

Predicted Effect

probably damaging
Transcript: ENSMUST00000208497
AA Change: I78F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000208598

Predicted Effect

probably benign
Transcript: ENSMUST00000208617

Predicted Effect

probably benign
Transcript: ENSMUST00000209107

Predicted Effect

probably benign
Transcript: ENSMUST00000208931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208820

Predicted Effect

probably benign
Transcript: ENSMUST00000209022

Predicted Effect

probably benign
Transcript: ENSMUST00000208819

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit heart defects, impaired development of Schwann cell precursors, cranial ganglia, and radial glia cells, and die at embryonic day 10.5-11.5. Heterozygotes are hyperactive with reduced NMDA receptors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	C	14: 32,660,217	S1264A	probably benign	Het
Adamts13	T	G	2: 27,008,711	Y1361*	probably null	Het
Ahrr	A	T	13: 74,214,212	D389E	probably damaging	Het
Alx3	T	C	3: 107,600,691	F172S	probably damaging	Het
Antxrl	A	G	14: 34,073,070	H485R	possibly damaging	Het
Aox4	A	G	1: 58,259,148	D1091G	probably null	Het
Btbd1	T	A	7: 81,805,810	Q271L	probably benign	Het
Cd209c	A	T	8: 3,944,953	N70K	probably benign	Het
Cdc14a	C	T	3: 116,294,750		probably null	Het
Cenpe	A	G	3: 135,248,151	M1641V	probably benign	Het
Clec2e	G	A	6: 129,100,827	T16I	probably benign	Het
Clp1	T	C	2: 84,725,875	D87G	possibly damaging	Het
Dpy19l1	A	T	9: 24,426,148	F517I	probably damaging	Het
Dzip3	T	C	16: 48,938,474	N646S	probably damaging	Het
Ephx1	T	A	1: 180,995,978	Y188F	possibly damaging	Het
Etfa	A	T	9: 55,495,767	H81Q	possibly damaging	Het
Gigyf2	T	A	1: 87,440,849	F1084I	probably damaging	Het
Heatr3	T	C	8: 88,141,783		probably null	Het
Ift81	G	T	5: 122,594,593	H293N	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Il6	T	G	5: 30,018,078	L114*	probably null	Het
Ism2	A	T	12: 87,299,581	M42K	probably benign	Het
Lhx5	A	G	5: 120,436,438	E269G	probably benign	Het
Marveld1	T	G	19: 42,147,995	M116R	possibly damaging	Het
Micall2	A	G	5: 139,706,886	S911P	probably damaging	Het
Mier1	G	A	4: 103,140,220	R195H	probably benign	Het
Muc2	T	A	7: 141,699,691		probably null	Het
Mybbp1a	A	G	11: 72,445,640	K486R	probably damaging	Het
Ncapd2	A	C	6: 125,185,745	L179R	probably damaging	Het
Nos1	C	T	5: 117,943,245	Q1171*	probably null	Het
Olfr1163	T	G	2: 88,070,729	T218P	probably benign	Het
Olfr220	T	G	1: 174,448,958	F112V	possibly damaging	Het
Plek2	C	T	12: 78,906,890		probably null	Het
Plod2	A	G	9: 92,595,272	H339R	probably damaging	Het
Pold1	C	T	7: 44,535,071	C835Y	probably damaging	Het
Polr1a	A	G	6: 71,950,868	I868V	probably benign	Het
Prss54	C	A	8: 95,559,375	V357L	probably benign	Het
Rbbp8	T	A	18: 11,722,670	S625T	probably damaging	Het
Rgs1	A	T	1: 144,247,929	L86Q	probably damaging	Het
Ripk4	T	A	16: 97,744,062	N462Y	probably damaging	Het
Rsf1	C	T	7: 97,676,222	L1011F	probably damaging	Het
Slc19a3	G	A	1: 83,019,341	T382I	probably damaging	Het
Slc9a2	G	A	1: 40,726,374	R308Q	probably damaging	Het
Top2b	T	A	14: 16,398,991	L537Q	probably damaging	Het
Trim45	C	A	3: 100,931,734		probably benign	Het
Umodl1	G	T	17: 30,984,002	R443M	possibly damaging	Het
Vmn1r11	G	A	6: 57,137,612	R87K	probably damaging	Het
Vmn1r78	T	A	7: 12,152,798	I112N	probably damaging	Het
Zeb2	T	G	2: 44,996,435	E825A	probably damaging	Het
Zfp930	A	T	8: 69,226,692	I50F	probably benign	Het

Other mutations in Nrg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Nrg1	APN	8	31818089	missense	probably damaging	0.99
IGL00500:Nrg1	APN	8	31822314	splice site	probably null
IGL01150:Nrg1	APN	8	31917875	missense	probably damaging	1.00
IGL01998:Nrg1	APN	8	31918134	missense	probably damaging	0.99
IGL02010:Nrg1	APN	8	31918143	missense	probably benign	0.00
IGL02501:Nrg1	APN	8	31818263	splice site	probably null
IGL02741:Nrg1	APN	8	31822288	missense	probably damaging	1.00
IGL02754:Nrg1	APN	8	31826363	splice site	probably benign
IGL03056:Nrg1	APN	8	31821423	missense	possibly damaging	0.93
IGL03121:Nrg1	APN	8	31824580	splice site	probably benign
R6805_Nrg1_535	UTSW	8	31821264	missense	probably damaging	1.00
R0533:Nrg1	UTSW	8	31831245	splice site	probably null
R1170:Nrg1	UTSW	8	31837667	splice site	probably benign
R1405:Nrg1	UTSW	8	31917827	missense	probably benign	0.16
R1405:Nrg1	UTSW	8	31917827	missense	probably benign	0.16
R1486:Nrg1	UTSW	8	31818344	missense	probably damaging	1.00
R1642:Nrg1	UTSW	8	31824508	missense	probably benign	0.45
R1653:Nrg1	UTSW	8	31818653	missense	probably damaging	1.00
R1762:Nrg1	UTSW	8	31822323	missense	probably damaging	0.99
R1951:Nrg1	UTSW	8	31918193	missense	probably damaging	1.00
R2060:Nrg1	UTSW	8	31918015	missense	probably damaging	1.00
R2912:Nrg1	UTSW	8	31818567	missense	probably damaging	1.00
R3786:Nrg1	UTSW	8	31821383	missense	probably damaging	1.00
R4513:Nrg1	UTSW	8	32477077	intron	probably benign
R4569:Nrg1	UTSW	8	31917774	missense	probably benign	0.00
R4760:Nrg1	UTSW	8	31918200	nonsense	probably null
R4834:Nrg1	UTSW	8	31917719	missense	probably benign
R5058:Nrg1	UTSW	8	31824559	missense	probably damaging	1.00
R5230:Nrg1	UTSW	8	31818479	missense	probably damaging	0.99
R5443:Nrg1	UTSW	8	31849320	missense	probably damaging	1.00
R5479:Nrg1	UTSW	8	31818377	missense	probably damaging	1.00
R5940:Nrg1	UTSW	8	31849344	missense	probably damaging	0.99
R6010:Nrg1	UTSW	8	31818572	missense	probably damaging	1.00
R6170:Nrg1	UTSW	8	31818480	missense	probably damaging	1.00
R6379:Nrg1	UTSW	8	32883721	start gained	probably benign
R6460:Nrg1	UTSW	8	31818533	missense	probably damaging	1.00
R6750:Nrg1	UTSW	8	31818096	missense	probably damaging	1.00
R6767:Nrg1	UTSW	8	31917895	missense	probably damaging	1.00
R6802:Nrg1	UTSW	8	31821264	missense	probably damaging	1.00
R6804:Nrg1	UTSW	8	31821264	missense	probably damaging	1.00
R6805:Nrg1	UTSW	8	31821264	missense	probably damaging	1.00
R6848:Nrg1	UTSW	8	31818056	missense	probably damaging	1.00
R6930:Nrg1	UTSW	8	31818506	missense	probably damaging	1.00
R6963:Nrg1	UTSW	8	31917662	missense	probably benign	0.04
R7070:Nrg1	UTSW	8	31849437	missense	probably damaging	0.99
R7176:Nrg1	UTSW	8	31968036	nonsense	probably null
R7490:Nrg1	UTSW	8	31818654	missense	probably damaging	1.00
R7526:Nrg1	UTSW	8	31818323	missense	probably benign	0.00
R7664:Nrg1	UTSW	8	32009141	splice site	probably null
R7881:Nrg1	UTSW	8	31838324	nonsense	probably null
R8013:Nrg1	UTSW	8	31949923	missense	probably benign	0.41
R8342:Nrg1	UTSW	8	31822306	missense	probably benign	0.04
R8759:Nrg1	UTSW	8	31818075	missense	probably damaging	1.00
R8783:Nrg1	UTSW	8	31958601	missense	probably benign	0.09
R9319:Nrg1	UTSW	8	31833176	missense	probably benign	0.02
R9429:Nrg1	UTSW	8	31818564	missense	probably benign	0.01
R9535:Nrg1	UTSW	8	31949967	missense	probably benign	0.13
R9632:Nrg1	UTSW	8	31917593	missense	possibly damaging	0.48
Z1088:Nrg1	UTSW	8	31918005	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TATGCCTCGGATGAGACCAG -3'
(R):5'- AGACATGTCTGAGGGAGCTG -3'

Sequencing Primer
(F):5'- CCTCGGATGAGACCAGAACAG -3'
(R):5'- CAGCCCCTCCACTCAGCTG -3'

Posted On

2015-12-21