Incidental Mutation 'R4769:Plek2'
ID 366350
Institutional Source Beutler Lab
Gene Symbol Plek2
Ensembl Gene ENSMUSG00000021118
Gene Name pleckstrin 2
Synonyms
Accession Numbers

Genbank: NM_013738; MGI: 1351466
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R4769 (G1)
Quality Score 203
Status Not validated
Chromosome 12
Chromosomal Location 78888691-78906964 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 78906890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021544]
AlphaFold Q9WV52
PDB Structure Solution structure of the DEP domain of mouse pleckstrin2 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000021544
SMART Domains Protein: ENSMUSP00000021544
Gene: ENSMUSG00000021118

DomainStartEndE-ValueType
PH 5 106 7.18e-15 SMART
DEP 139 225 3.49e-19 SMART
PH 248 353 5e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with membrane-bound phosphatidylinositols generated by phosphatidylinositol 3-kinase. The encoded protein then interacts with the actin cytoskeleton to induce cell spreading. In conjunction with complement component 1, q subcomponent, B chain (C1QB), this gene shows an increase in expression in melanoma cells and may serve as an accurate biomarker for the disease. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(1) : Targeted, other(1)
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Plek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Plek2 APN 12 78894953 missense possibly damaging 0.68
IGL01945:Plek2 APN 12 78892148 missense probably damaging 1.00
3-1:Plek2 UTSW 12 78894172 missense possibly damaging 0.89
R0141:Plek2 UTSW 12 78894504 missense probably damaging 1.00
R0555:Plek2 UTSW 12 78892172 missense probably damaging 1.00
R1686:Plek2 UTSW 12 78894410 missense probably damaging 1.00
R1925:Plek2 UTSW 12 78894890 missense probably damaging 1.00
R5595:Plek2 UTSW 12 78894109 missense probably benign
R6102:Plek2 UTSW 12 78900093 missense possibly damaging 0.56
R6474:Plek2 UTSW 12 78896291 missense probably benign 0.08
R6943:Plek2 UTSW 12 78889309 critical splice acceptor site probably null
R7423:Plek2 UTSW 12 78900110 missense probably damaging 1.00
R8155:Plek2 UTSW 12 78896292 nonsense probably null
X0013:Plek2 UTSW 12 78894521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTTTAAGAGATCCACCGGAG -3'
(R):5'- CTATAGACAGAGGTCCAGGGTC -3'

Sequencing Primer
(F):5'- TCCACCGGAGAGAGTAAGCC -3'
(R):5'- CGTGTTCTTGGGCGATCACC -3'
Posted On 2015-12-21