Incidental Mutation 'R4769:Antxrl'
ID366355
Institutional Source Beutler Lab
Gene Symbol Antxrl
Ensembl Gene ENSMUSG00000047441
Gene Nameanthrax toxin receptor-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34052707-34076405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34073070 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 485 (H485R)
Ref Sequence ENSEMBL: ENSMUSP00000052816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058725] [ENSMUST00000178958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058725
AA Change: H485R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052816
Gene: ENSMUSG00000047441
AA Change: H485R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 74 248 2.9e-19 SMART
Pfam:Anth_Ig 249 351 6.7e-41 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 392 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215823
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Antxrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Antxrl APN 14 34075597 missense probably benign 0.01
IGL01632:Antxrl APN 14 34067947 missense probably damaging 0.99
IGL02379:Antxrl APN 14 34056535 splice site probably null
IGL02381:Antxrl APN 14 34056611 unclassified probably null
IGL02736:Antxrl APN 14 34056618 unclassified probably benign
R0631:Antxrl UTSW 14 34058801 critical splice donor site probably null
R1190:Antxrl UTSW 14 34069250 missense probably benign 0.00
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1454:Antxrl UTSW 14 34060949 missense probably damaging 0.99
R1469:Antxrl UTSW 14 34067431 intron probably benign
R1638:Antxrl UTSW 14 34070496 critical splice donor site probably null
R1996:Antxrl UTSW 14 34075829 missense probably benign 0.01
R2174:Antxrl UTSW 14 34060400 missense probably damaging 1.00
R2421:Antxrl UTSW 14 34071689 intron probably benign
R3850:Antxrl UTSW 14 34067381 missense probably benign 0.00
R4178:Antxrl UTSW 14 34054971 unclassified probably null
R4434:Antxrl UTSW 14 34071617 intron probably benign
R4603:Antxrl UTSW 14 34075835 missense possibly damaging 0.72
R6003:Antxrl UTSW 14 34075635 missense possibly damaging 0.72
R6047:Antxrl UTSW 14 34053476 intron probably benign
R6228:Antxrl UTSW 14 34056599 missense probably damaging 1.00
R6363:Antxrl UTSW 14 34069287 missense probably damaging 1.00
R6525:Antxrl UTSW 14 34060406 missense probably damaging 1.00
R6800:Antxrl UTSW 14 34065907 missense probably damaging 1.00
R6933:Antxrl UTSW 14 34075771 missense possibly damaging 0.53
R7086:Antxrl UTSW 14 34065916 missense probably benign 0.26
R7257:Antxrl UTSW 14 34065849 missense probably benign 0.03
R7315:Antxrl UTSW 14 34071547 missense unknown
X0028:Antxrl UTSW 14 34053915 critical splice donor site probably null
Z1088:Antxrl UTSW 14 34067971 missense probably damaging 1.00
Z1177:Antxrl UTSW 14 34067930 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCAGGTCTTTAGACTGGTCTC -3'
(R):5'- CCCAGCTGACACTTAGCTTTG -3'

Sequencing Primer
(F):5'- AGACTGGTCTCTCTCTGGAG -3'
(R):5'- ACTCTTCAGGGGACTTCAGG -3'
Posted On2015-12-21