Mutagenetix > Incidental Mutation

Incidental Mutation 'R4769:Ripk4'

366358

Institutional Source

Beutler Lab

Gene Symbol

Ripk4

Ensembl Gene

ENSMUSG00000005251

Gene Name

receptor-interacting serine-threonine kinase 4

Synonyms

Ankrd3, DIk, PKK, ANKK2, RIP4

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R4769 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97741933-97763787 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 97744062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 462 (N462Y)

Ref Sequence

ENSEMBL: ENSMUSP00000019386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019386] [ENSMUST00000113743]

AlphaFold

Q9ERK0

Predicted Effect

probably damaging
Transcript: ENSMUST00000019386
AA Change: N462Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: N462Y

Domain	Start	End	E-Value	Type
Pfam:Pkinase	22	283	1.8e-47	PFAM
Pfam:Pkinase_Tyr	23	283	6e-45	PFAM
low complexity region	356	396	N/A	INTRINSIC
ANK	439	468	2.58e-3	SMART
ANK	472	501	3.41e-3	SMART
ANK	505	534	7.42e-4	SMART
ANK	538	567	3.57e-6	SMART
ANK	571	601	3.85e-2	SMART
ANK	605	634	3.15e-7	SMART
ANK	638	667	5.16e-3	SMART
ANK	671	700	2.2e-6	SMART
ANK	704	734	1.68e-2	SMART
ANK	736	765	3.46e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113743
AA Change: N399Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109372
Gene: ENSMUSG00000005251
AA Change: N399Y

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	220	1e-39	PFAM
Pfam:Pkinase_Tyr	1	220	7.4e-39	PFAM
low complexity region	293	333	N/A	INTRINSIC
ANK	376	405	2.58e-3	SMART
ANK	409	438	3.41e-3	SMART
ANK	442	471	7.42e-4	SMART
ANK	475	504	3.57e-6	SMART
ANK	508	538	3.85e-2	SMART
ANK	542	571	3.15e-7	SMART
ANK	575	604	5.16e-3	SMART
ANK	608	637	2.2e-6	SMART
ANK	641	671	1.68e-2	SMART
ANK	673	702	3.46e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	C	14: 32,660,217	S1264A	probably benign	Het
Adamts13	T	G	2: 27,008,711	Y1361*	probably null	Het
Ahrr	A	T	13: 74,214,212	D389E	probably damaging	Het
Alx3	T	C	3: 107,600,691	F172S	probably damaging	Het
Antxrl	A	G	14: 34,073,070	H485R	possibly damaging	Het
Aox4	A	G	1: 58,259,148	D1091G	probably null	Het
Btbd1	T	A	7: 81,805,810	Q271L	probably benign	Het
Cd209c	A	T	8: 3,944,953	N70K	probably benign	Het
Cdc14a	C	T	3: 116,294,750		probably null	Het
Cenpe	A	G	3: 135,248,151	M1641V	probably benign	Het
Clec2e	G	A	6: 129,100,827	T16I	probably benign	Het
Clp1	T	C	2: 84,725,875	D87G	possibly damaging	Het
Dpy19l1	A	T	9: 24,426,148	F517I	probably damaging	Het
Dzip3	T	C	16: 48,938,474	N646S	probably damaging	Het
Ephx1	T	A	1: 180,995,978	Y188F	possibly damaging	Het
Etfa	A	T	9: 55,495,767	H81Q	possibly damaging	Het
Gigyf2	T	A	1: 87,440,849	F1084I	probably damaging	Het
Heatr3	T	C	8: 88,141,783		probably null	Het
Ift81	G	T	5: 122,594,593	H293N	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Il6	T	G	5: 30,018,078	L114*	probably null	Het
Ism2	A	T	12: 87,299,581	M42K	probably benign	Het
Lhx5	A	G	5: 120,436,438	E269G	probably benign	Het
Marveld1	T	G	19: 42,147,995	M116R	possibly damaging	Het
Micall2	A	G	5: 139,706,886	S911P	probably damaging	Het
Mier1	G	A	4: 103,140,220	R195H	probably benign	Het
Muc2	T	A	7: 141,699,691		probably null	Het
Mybbp1a	A	G	11: 72,445,640	K486R	probably damaging	Het
Ncapd2	A	C	6: 125,185,745	L179R	probably damaging	Het
Nos1	C	T	5: 117,943,245	Q1171*	probably null	Het
Nrg1	T	A	8: 31,917,972	I78F	probably damaging	Het
Olfr1163	T	G	2: 88,070,729	T218P	probably benign	Het
Olfr220	T	G	1: 174,448,958	F112V	possibly damaging	Het
Plek2	C	T	12: 78,906,890		probably null	Het
Plod2	A	G	9: 92,595,272	H339R	probably damaging	Het
Pold1	C	T	7: 44,535,071	C835Y	probably damaging	Het
Polr1a	A	G	6: 71,950,868	I868V	probably benign	Het
Prss54	C	A	8: 95,559,375	V357L	probably benign	Het
Rbbp8	T	A	18: 11,722,670	S625T	probably damaging	Het
Rgs1	A	T	1: 144,247,929	L86Q	probably damaging	Het
Rsf1	C	T	7: 97,676,222	L1011F	probably damaging	Het
Slc19a3	G	A	1: 83,019,341	T382I	probably damaging	Het
Slc9a2	G	A	1: 40,726,374	R308Q	probably damaging	Het
Top2b	T	A	14: 16,398,991	L537Q	probably damaging	Het
Trim45	C	A	3: 100,931,734		probably benign	Het
Umodl1	G	T	17: 30,984,002	R443M	possibly damaging	Het
Vmn1r11	G	A	6: 57,137,612	R87K	probably damaging	Het
Vmn1r78	T	A	7: 12,152,798	I112N	probably damaging	Het
Zeb2	T	G	2: 44,996,435	E825A	probably damaging	Het
Zfp930	A	T	8: 69,226,692	I50F	probably benign	Het

Other mutations in Ripk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Ripk4	APN	16	97751496	nonsense	probably null
IGL01823:Ripk4	APN	16	97755283	missense	possibly damaging	0.89
IGL01921:Ripk4	APN	16	97743365	missense	possibly damaging	0.62
IGL02023:Ripk4	APN	16	97755231	missense	probably damaging	1.00
IGL02201:Ripk4	APN	16	97755177	missense	possibly damaging	0.91
IGL02709:Ripk4	APN	16	97743566	missense	probably damaging	1.00
G1citation:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
I2288:Ripk4	UTSW	16	97748145	missense	probably benign	0.16
PIT4495001:Ripk4	UTSW	16	97743170	missense	probably damaging	0.99
R0060:Ripk4	UTSW	16	97763518	splice site	probably benign
R0112:Ripk4	UTSW	16	97743561	missense	probably benign	0.00
R0383:Ripk4	UTSW	16	97748112	missense	probably damaging	1.00
R0524:Ripk4	UTSW	16	97755287	nonsense	probably null
R0540:Ripk4	UTSW	16	97744175	missense	probably damaging	1.00
R0967:Ripk4	UTSW	16	97744172	missense	probably damaging	1.00
R1646:Ripk4	UTSW	16	97743897	missense	probably damaging	1.00
R1785:Ripk4	UTSW	16	97750131	missense	probably damaging	1.00
R2058:Ripk4	UTSW	16	97744142	nonsense	probably null
R2134:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R2135:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R3410:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R3411:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R4538:Ripk4	UTSW	16	97743152	nonsense	probably null
R4627:Ripk4	UTSW	16	97744026	missense	probably damaging	0.99
R4665:Ripk4	UTSW	16	97755073	missense	probably damaging	0.98
R4704:Ripk4	UTSW	16	97746004	nonsense	probably null
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R5240:Ripk4	UTSW	16	97743767	missense	probably damaging	1.00
R5864:Ripk4	UTSW	16	97763582	missense	probably damaging	0.98
R6027:Ripk4	UTSW	16	97744074	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6291:Ripk4	UTSW	16	97755123	missense	probably damaging	1.00
R6343:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R6572:Ripk4	UTSW	16	97745905	nonsense	probably null
R6783:Ripk4	UTSW	16	97748037	missense	probably damaging	1.00
R6822:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
R7215:Ripk4	UTSW	16	97747323	splice site	probably null
R7251:Ripk4	UTSW	16	97743249	missense	probably benign
R7275:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R7356:Ripk4	UTSW	16	97743149	missense	probably damaging	0.98
R7621:Ripk4	UTSW	16	97745925	missense	probably damaging	1.00
R8065:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8067:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8191:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R8742:Ripk4	UTSW	16	97755072	missense	probably damaging	1.00
R8968:Ripk4	UTSW	16	97746003	missense	probably benign	0.38
R9209:Ripk4	UTSW	16	97750111	missense	possibly damaging	0.74
R9513:Ripk4	UTSW	16	97745898	nonsense	probably null
R9784:Ripk4	UTSW	16	97748106	missense	possibly damaging	0.46
Z1176:Ripk4	UTSW	16	97750102	missense	probably damaging	1.00
Z1177:Ripk4	UTSW	16	97755178	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CATTCTGGGCTGCAAAGTG -3'
(R):5'- GCCCACATTCTATAGTGGTTGC -3'

Sequencing Primer
(F):5'- CAAAGTGCAGGGCAGTCCAC -3'
(R):5'- TCTCCCTGCAGACCTGG -3'

Posted On

2015-12-21