Mutagenetix > Incidental Mutation

Incidental Mutation 'R4769:Umodl1'

366360

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4769 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31173614-31229684 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 31202976 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Methionine at position 443 (R443M)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066554
AA Change: R443M

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: R443M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066981
AA Change: R443M

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: R443M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114555
AA Change: R443M

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: R443M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	C	14: 32,382,174 (GRCm39)	S1264A	probably benign	Het
Adamts13	T	G	2: 26,898,723 (GRCm39)	Y1361*	probably null	Het
Ahrr	A	T	13: 74,362,331 (GRCm39)	D389E	probably damaging	Het
Alx3	T	C	3: 107,508,007 (GRCm39)	F172S	probably damaging	Het
Antxrl	A	G	14: 33,795,027 (GRCm39)	H485R	possibly damaging	Het
Aox4	A	G	1: 58,298,307 (GRCm39)	D1091G	probably null	Het
Btbd1	T	A	7: 81,455,558 (GRCm39)	Q271L	probably benign	Het
Cd209c	A	T	8: 3,994,953 (GRCm39)	N70K	probably benign	Het
Cdc14a	C	T	3: 116,088,399 (GRCm39)		probably null	Het
Cenpe	A	G	3: 134,953,912 (GRCm39)	M1641V	probably benign	Het
Clec2e	G	A	6: 129,077,790 (GRCm39)	T16I	probably benign	Het
Clp1	T	C	2: 84,556,219 (GRCm39)	D87G	possibly damaging	Het
Dpy19l1	A	T	9: 24,337,444 (GRCm39)	F517I	probably damaging	Het
Dzip3	T	C	16: 48,758,837 (GRCm39)	N646S	probably damaging	Het
Ephx1	T	A	1: 180,823,543 (GRCm39)	Y188F	possibly damaging	Het
Etfa	A	T	9: 55,403,051 (GRCm39)	H81Q	possibly damaging	Het
Gigyf2	T	A	1: 87,368,571 (GRCm39)	F1084I	probably damaging	Het
Heatr3	T	C	8: 88,868,411 (GRCm39)		probably null	Het
Ift81	G	T	5: 122,732,656 (GRCm39)	H293N	probably benign	Het
Igkv9-120	G	T	6: 68,027,351 (GRCm39)	R88S	possibly damaging	Het
Il6	T	G	5: 30,223,076 (GRCm39)	L114*	probably null	Het
Ism2	A	T	12: 87,346,355 (GRCm39)	M42K	probably benign	Het
Lhx5	A	G	5: 120,574,503 (GRCm39)	E269G	probably benign	Het
Marveld1	T	G	19: 42,136,434 (GRCm39)	M116R	possibly damaging	Het
Micall2	A	G	5: 139,692,641 (GRCm39)	S911P	probably damaging	Het
Mier1	G	A	4: 102,997,417 (GRCm39)	R195H	probably benign	Het
Muc2	T	A	7: 141,286,260 (GRCm39)		probably null	Het
Mybbp1a	A	G	11: 72,336,466 (GRCm39)	K486R	probably damaging	Het
Ncapd2	A	C	6: 125,162,708 (GRCm39)	L179R	probably damaging	Het
Nos1	C	T	5: 118,081,310 (GRCm39)	Q1171*	probably null	Het
Nrg1	T	A	8: 32,408,000 (GRCm39)	I78F	probably damaging	Het
Or5d36	T	G	2: 87,901,073 (GRCm39)	T218P	probably benign	Het
Or6y1	T	G	1: 174,276,524 (GRCm39)	F112V	possibly damaging	Het
Plek2	C	T	12: 78,953,664 (GRCm39)		probably null	Het
Plod2	A	G	9: 92,477,325 (GRCm39)	H339R	probably damaging	Het
Pold1	C	T	7: 44,184,495 (GRCm39)	C835Y	probably damaging	Het
Polr1a	A	G	6: 71,927,852 (GRCm39)	I868V	probably benign	Het
Prss54	C	A	8: 96,286,003 (GRCm39)	V357L	probably benign	Het
Rbbp8	T	A	18: 11,855,727 (GRCm39)	S625T	probably damaging	Het
Rgs1	A	T	1: 144,123,667 (GRCm39)	L86Q	probably damaging	Het
Ripk4	T	A	16: 97,545,262 (GRCm39)	N462Y	probably damaging	Het
Rsf1	C	T	7: 97,325,429 (GRCm39)	L1011F	probably damaging	Het
Slc19a3	G	A	1: 82,997,062 (GRCm39)	T382I	probably damaging	Het
Slc9a2	G	A	1: 40,765,534 (GRCm39)	R308Q	probably damaging	Het
Top2b	T	A	14: 16,398,991 (GRCm38)	L537Q	probably damaging	Het
Trim45	C	A	3: 100,839,050 (GRCm39)		probably benign	Het
Vmn1r11	G	A	6: 57,114,597 (GRCm39)	R87K	probably damaging	Het
Vmn1r78	T	A	7: 11,886,725 (GRCm39)	I112N	probably damaging	Het
Zeb2	T	G	2: 44,886,447 (GRCm39)	E825A	probably damaging	Het
Zfp930	A	T	8: 69,679,344 (GRCm39)	I50F	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31,227,724 (GRCm39)	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	31,215,238 (GRCm39)	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	31,215,233 (GRCm39)	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	31,217,800 (GRCm39)	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	31,215,229 (GRCm39)	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	31,201,294 (GRCm39)	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	31,192,742 (GRCm39)	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	31,206,888 (GRCm39)	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	31,205,091 (GRCm39)	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	31,213,789 (GRCm39)	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	31,187,415 (GRCm39)	splice site	probably benign
IGL02496:Umodl1	APN	17	31,217,628 (GRCm39)	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	31,208,462 (GRCm39)	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	31,205,473 (GRCm39)	nonsense	probably null
IGL03392:Umodl1	APN	17	31,215,329 (GRCm39)	missense	probably damaging	0.98
Disquieting	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
floored	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7231_umodl1_507	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
surprising	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
unsettling	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
G1citation:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	31,203,002 (GRCm39)	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	31,215,325 (GRCm39)	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	31,178,347 (GRCm39)	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31,221,772 (GRCm39)	splice site	probably benign
R1231:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	31,205,478 (GRCm39)	missense	probably benign	0.05
R1459:Umodl1	UTSW	17	31,201,232 (GRCm39)	splice site	probably benign
R1510:Umodl1	UTSW	17	31,178,203 (GRCm39)	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	31,206,942 (GRCm39)	missense	probably benign
R1757:Umodl1	UTSW	17	31,227,674 (GRCm39)	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	31,187,524 (GRCm39)	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	31,201,238 (GRCm39)	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	31,211,128 (GRCm39)	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	31,211,062 (GRCm39)	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	31,211,147 (GRCm39)	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	31,208,502 (GRCm39)	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31,221,837 (GRCm39)	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	31,203,763 (GRCm39)	nonsense	probably null
R4207:Umodl1	UTSW	17	31,178,341 (GRCm39)	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	31,207,039 (GRCm39)	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	31,213,789 (GRCm39)	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	31,217,088 (GRCm39)	missense	probably benign	0.00
R4887:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	31,218,175 (GRCm39)	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	31,205,055 (GRCm39)	missense	probably benign
R4993:Umodl1	UTSW	17	31,205,459 (GRCm39)	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	31,203,066 (GRCm39)	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	31,199,333 (GRCm39)	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	31,201,263 (GRCm39)	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	31,213,761 (GRCm39)	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	31,215,256 (GRCm39)	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31,221,866 (GRCm39)	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	31,201,325 (GRCm39)	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	31,205,121 (GRCm39)	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	31,205,273 (GRCm39)	splice site	probably null
R6822:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
R6999:Umodl1	UTSW	17	31,218,097 (GRCm39)	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	31,201,246 (GRCm39)	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	31,201,318 (GRCm39)	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	31,201,236 (GRCm39)	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	31,205,595 (GRCm39)	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	31,201,306 (GRCm39)	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	31,217,122 (GRCm39)	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7594:Umodl1	UTSW	17	31,173,779 (GRCm39)	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7763:Umodl1	UTSW	17	31,205,430 (GRCm39)	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	31,178,125 (GRCm39)	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	31,192,666 (GRCm39)	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	31,205,361 (GRCm39)	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	31,192,770 (GRCm39)	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	31,190,792 (GRCm39)	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	31,203,806 (GRCm39)	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	31,202,958 (GRCm39)	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	31,192,677 (GRCm39)	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	31,178,147 (GRCm39)	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	31,215,367 (GRCm39)	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	31,217,143 (GRCm39)	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	31,217,152 (GRCm39)	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	31,178,324 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCCTTCAAGGACAGTTGGG -3'
(R):5'- CCTTGCACGAATGTCCTCTG -3'

Sequencing Primer
(F):5'- TGGACTGTCCATGAGTAGCCAG -3'
(R):5'- TCTGCTGGTCAACCTGGAACAC -3'

Posted On

2015-12-21