Incidental Mutation 'R4769:Rbbp8'
ID 366361
Institutional Source Beutler Lab
Gene Symbol Rbbp8
Ensembl Gene ENSMUSG00000041238
Gene Name retinoblastoma binding protein 8, endonuclease
Synonyms CtIP, 9930104E21Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4769 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 11766333-11876264 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11855727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 625 (S625T)
Ref Sequence ENSEMBL: ENSMUSP00000111527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]
AlphaFold Q80YR6
Predicted Effect probably damaging
Transcript: ENSMUST00000047322
AA Change: S625T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: S625T

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 9.6e-61 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 790 854 8.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115861
AA Change: S625T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: S625T

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 5.2e-55 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 817 854 1.4e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,382,174 (GRCm39) S1264A probably benign Het
Adamts13 T G 2: 26,898,723 (GRCm39) Y1361* probably null Het
Ahrr A T 13: 74,362,331 (GRCm39) D389E probably damaging Het
Alx3 T C 3: 107,508,007 (GRCm39) F172S probably damaging Het
Antxrl A G 14: 33,795,027 (GRCm39) H485R possibly damaging Het
Aox4 A G 1: 58,298,307 (GRCm39) D1091G probably null Het
Btbd1 T A 7: 81,455,558 (GRCm39) Q271L probably benign Het
Cd209c A T 8: 3,994,953 (GRCm39) N70K probably benign Het
Cdc14a C T 3: 116,088,399 (GRCm39) probably null Het
Cenpe A G 3: 134,953,912 (GRCm39) M1641V probably benign Het
Clec2e G A 6: 129,077,790 (GRCm39) T16I probably benign Het
Clp1 T C 2: 84,556,219 (GRCm39) D87G possibly damaging Het
Dpy19l1 A T 9: 24,337,444 (GRCm39) F517I probably damaging Het
Dzip3 T C 16: 48,758,837 (GRCm39) N646S probably damaging Het
Ephx1 T A 1: 180,823,543 (GRCm39) Y188F possibly damaging Het
Etfa A T 9: 55,403,051 (GRCm39) H81Q possibly damaging Het
Gigyf2 T A 1: 87,368,571 (GRCm39) F1084I probably damaging Het
Heatr3 T C 8: 88,868,411 (GRCm39) probably null Het
Ift81 G T 5: 122,732,656 (GRCm39) H293N probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Il6 T G 5: 30,223,076 (GRCm39) L114* probably null Het
Ism2 A T 12: 87,346,355 (GRCm39) M42K probably benign Het
Lhx5 A G 5: 120,574,503 (GRCm39) E269G probably benign Het
Marveld1 T G 19: 42,136,434 (GRCm39) M116R possibly damaging Het
Micall2 A G 5: 139,692,641 (GRCm39) S911P probably damaging Het
Mier1 G A 4: 102,997,417 (GRCm39) R195H probably benign Het
Muc2 T A 7: 141,286,260 (GRCm39) probably null Het
Mybbp1a A G 11: 72,336,466 (GRCm39) K486R probably damaging Het
Ncapd2 A C 6: 125,162,708 (GRCm39) L179R probably damaging Het
Nos1 C T 5: 118,081,310 (GRCm39) Q1171* probably null Het
Nrg1 T A 8: 32,408,000 (GRCm39) I78F probably damaging Het
Or5d36 T G 2: 87,901,073 (GRCm39) T218P probably benign Het
Or6y1 T G 1: 174,276,524 (GRCm39) F112V possibly damaging Het
Plek2 C T 12: 78,953,664 (GRCm39) probably null Het
Plod2 A G 9: 92,477,325 (GRCm39) H339R probably damaging Het
Pold1 C T 7: 44,184,495 (GRCm39) C835Y probably damaging Het
Polr1a A G 6: 71,927,852 (GRCm39) I868V probably benign Het
Prss54 C A 8: 96,286,003 (GRCm39) V357L probably benign Het
Rgs1 A T 1: 144,123,667 (GRCm39) L86Q probably damaging Het
Ripk4 T A 16: 97,545,262 (GRCm39) N462Y probably damaging Het
Rsf1 C T 7: 97,325,429 (GRCm39) L1011F probably damaging Het
Slc19a3 G A 1: 82,997,062 (GRCm39) T382I probably damaging Het
Slc9a2 G A 1: 40,765,534 (GRCm39) R308Q probably damaging Het
Top2b T A 14: 16,398,991 (GRCm38) L537Q probably damaging Het
Trim45 C A 3: 100,839,050 (GRCm39) probably benign Het
Umodl1 G T 17: 31,202,976 (GRCm39) R443M possibly damaging Het
Vmn1r11 G A 6: 57,114,597 (GRCm39) R87K probably damaging Het
Vmn1r78 T A 7: 11,886,725 (GRCm39) I112N probably damaging Het
Zeb2 T G 2: 44,886,447 (GRCm39) E825A probably damaging Het
Zfp930 A T 8: 69,679,344 (GRCm39) I50F probably benign Het
Other mutations in Rbbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rbbp8 APN 18 11,855,664 (GRCm39) missense probably benign
IGL01302:Rbbp8 APN 18 11,855,036 (GRCm39) missense probably benign
IGL01965:Rbbp8 APN 18 11,855,317 (GRCm39) missense probably benign 0.04
IGL02076:Rbbp8 APN 18 11,838,876 (GRCm39) missense probably damaging 1.00
IGL02410:Rbbp8 APN 18 11,865,269 (GRCm39) missense probably damaging 1.00
IGL02823:Rbbp8 APN 18 11,865,270 (GRCm39) missense possibly damaging 0.89
IGL02859:Rbbp8 APN 18 11,871,671 (GRCm39) missense probably benign 0.42
IGL02966:Rbbp8 APN 18 11,838,869 (GRCm39) missense possibly damaging 0.88
IGL03022:Rbbp8 APN 18 11,858,559 (GRCm39) splice site probably benign
IGL03274:Rbbp8 APN 18 11,874,133 (GRCm39) splice site probably benign
IGL03367:Rbbp8 APN 18 11,854,776 (GRCm39) missense probably benign 0.08
R0063:Rbbp8 UTSW 18 11,867,614 (GRCm39) splice site probably benign
R0063:Rbbp8 UTSW 18 11,867,614 (GRCm39) splice site probably benign
R0167:Rbbp8 UTSW 18 11,793,979 (GRCm39) nonsense probably null
R0314:Rbbp8 UTSW 18 11,848,875 (GRCm39) missense probably benign 0.17
R0864:Rbbp8 UTSW 18 11,865,241 (GRCm39) splice site probably benign
R1033:Rbbp8 UTSW 18 11,875,762 (GRCm39) missense probably benign 0.41
R1678:Rbbp8 UTSW 18 11,865,372 (GRCm39) missense probably benign 0.05
R1964:Rbbp8 UTSW 18 11,875,736 (GRCm39) missense possibly damaging 0.62
R2002:Rbbp8 UTSW 18 11,860,223 (GRCm39) splice site probably benign
R2015:Rbbp8 UTSW 18 11,853,681 (GRCm39) missense probably benign 0.01
R2240:Rbbp8 UTSW 18 11,810,726 (GRCm39) missense probably damaging 0.99
R2308:Rbbp8 UTSW 18 11,829,833 (GRCm39) missense possibly damaging 0.95
R3946:Rbbp8 UTSW 18 11,851,925 (GRCm39) missense probably benign
R4375:Rbbp8 UTSW 18 11,858,467 (GRCm39) missense probably benign 0.00
R4590:Rbbp8 UTSW 18 11,865,322 (GRCm39) nonsense probably null
R4695:Rbbp8 UTSW 18 11,854,839 (GRCm39) nonsense probably null
R5161:Rbbp8 UTSW 18 11,855,171 (GRCm39) missense probably damaging 1.00
R5195:Rbbp8 UTSW 18 11,855,208 (GRCm39) missense probably benign 0.00
R5223:Rbbp8 UTSW 18 11,854,747 (GRCm39) missense probably benign 0.19
R5573:Rbbp8 UTSW 18 11,855,664 (GRCm39) missense probably benign
R5671:Rbbp8 UTSW 18 11,875,699 (GRCm39) missense probably benign 0.00
R6051:Rbbp8 UTSW 18 11,871,664 (GRCm39) missense probably benign 0.17
R6995:Rbbp8 UTSW 18 11,851,965 (GRCm39) missense probably damaging 1.00
R7048:Rbbp8 UTSW 18 11,865,277 (GRCm39) missense possibly damaging 0.92
R7261:Rbbp8 UTSW 18 11,838,799 (GRCm39) missense probably damaging 0.99
R7305:Rbbp8 UTSW 18 11,805,638 (GRCm39) critical splice acceptor site probably null
R7319:Rbbp8 UTSW 18 11,865,269 (GRCm39) missense probably damaging 1.00
R7447:Rbbp8 UTSW 18 11,793,934 (GRCm39) missense probably benign 0.00
R7949:Rbbp8 UTSW 18 11,851,892 (GRCm39) missense probably benign 0.00
R8010:Rbbp8 UTSW 18 11,855,290 (GRCm39) missense possibly damaging 0.67
R8116:Rbbp8 UTSW 18 11,855,727 (GRCm39) missense probably damaging 1.00
R8292:Rbbp8 UTSW 18 11,838,769 (GRCm39) missense probably benign
R8300:Rbbp8 UTSW 18 11,838,833 (GRCm39) synonymous silent
R8314:Rbbp8 UTSW 18 11,853,682 (GRCm39) missense probably benign 0.06
R8510:Rbbp8 UTSW 18 11,829,859 (GRCm39) nonsense probably null
R8961:Rbbp8 UTSW 18 11,865,262 (GRCm39) missense probably benign 0.18
R9056:Rbbp8 UTSW 18 11,810,677 (GRCm39) missense possibly damaging 0.65
R9086:Rbbp8 UTSW 18 11,875,736 (GRCm39) missense possibly damaging 0.62
R9375:Rbbp8 UTSW 18 11,838,888 (GRCm39) missense probably benign
R9391:Rbbp8 UTSW 18 11,854,990 (GRCm39) missense possibly damaging 0.49
R9763:Rbbp8 UTSW 18 11,865,261 (GRCm39) missense probably benign 0.01
Z1176:Rbbp8 UTSW 18 11,865,319 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTTCAAAACACCTCCATGTTCAC -3'
(R):5'- GATGAAACCAGTGAGAATTATGCTG -3'

Sequencing Primer
(F):5'- CCTCCATGTTCACAGGAAAGTTTGG -3'
(R):5'- CCAGTGAGAATTATGCTGCGAAC -3'
Posted On 2015-12-21