Incidental Mutation 'R4780:Kiz'
ID366386
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
MMRRC Submission 041993-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4780 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146889246 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 192 (T192A)
Ref Sequence ENSEMBL: ENSMUSP00000121952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]
Predicted Effect probably benign
Transcript: ENSMUST00000099278
AA Change: T219A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: T219A

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156232
AA Change: T192A

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749
AA Change: T192A

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,370 N107D probably benign Het
4833413E03Rik A C 17: 31,558,764 noncoding transcript Het
4931429L15Rik G T 9: 46,308,846 H129Q possibly damaging Het
A730018C14Rik A G 12: 112,415,635 noncoding transcript Het
Abcc6 T A 7: 45,996,691 K791N probably benign Het
Adcy4 T G 14: 55,775,036 Q550P probably benign Het
Add3 C A 19: 53,234,792 A325E possibly damaging Het
Agbl4 T A 4: 111,657,331 I513N possibly damaging Het
Agfg1 C A 1: 82,886,387 T392K probably damaging Het
Akna C A 4: 63,379,254 M854I probably benign Het
Ankrd44 T C 1: 54,763,757 N194S probably benign Het
Anks1b A G 10: 89,873,732 K21E probably damaging Het
Ap1s3 A G 1: 79,609,172 F154L probably benign Het
Apbb2 T A 5: 66,362,817 N477I probably damaging Het
Apobec3 T C 15: 79,899,024 C101R possibly damaging Het
Arnt G T 3: 95,488,385 V410F probably damaging Het
Arsg G A 11: 109,534,013 R270H possibly damaging Het
B3gnt7 T A 1: 86,305,270 D79E probably damaging Het
BC067074 A G 13: 113,317,858 Y146C probably damaging Het
Cd44 G T 2: 102,861,565 A126D probably damaging Het
Cd69 A G 6: 129,271,355 I56T probably damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces2a T C 8: 104,737,208 F184S probably damaging Het
Chrng A G 1: 87,207,524 N185S probably damaging Het
Cldn6 A T 17: 23,681,247 M62L probably benign Het
Cntn6 T A 6: 104,845,784 N765K probably damaging Het
Ctnnal1 T C 4: 56,847,857 D94G probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Depdc1a A G 3: 159,526,706 N698S probably benign Het
Dnah2 A T 11: 69,473,871 I1986N probably damaging Het
Dnah7b A G 1: 46,353,014 E3845G probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Dync1h1 T C 12: 110,661,196 Y4047H probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
E2f5 A G 3: 14,587,319 T72A probably benign Het
Ephb6 G T 6: 41,616,139 R437L probably damaging Het
Erbb4 T C 1: 68,298,314 H615R probably damaging Het
Erbin T C 13: 103,884,206 T82A probably damaging Het
Eri2 T C 7: 119,785,680 N533D probably benign Het
Fkbp9 A G 6: 56,850,716 N174S probably damaging Het
Fsbp C T 4: 11,583,709 T136I possibly damaging Het
Fubp3 C A 2: 31,583,211 D47E probably damaging Het
Gm21850 G A 2: 154,056,499 noncoding transcript Het
Gm5141 T A 13: 62,774,950 Y135F unknown Het
Gm7353 T A 7: 3,110,725 noncoding transcript Het
Gm8765 C A 13: 50,701,080 S251R probably damaging Het
Gm9925 T C 18: 74,065,273 probably benign Het
Greb1l T C 18: 10,541,792 S1180P probably benign Het
Hist1h2ag G A 13: 22,042,909 Q7* probably null Het
Klhl24 T A 16: 20,106,958 C79S probably damaging Het
Map3k11 A G 19: 5,690,938 H231R probably damaging Het
Mbd4 C A 6: 115,849,384 R194S probably benign Het
Mettl21e A C 1: 44,211,143 S34R probably benign Het
Mrps5 T C 2: 127,598,241 V245A probably benign Het
Mtrf1 T C 14: 79,401,688 Y87H probably benign Het
Myh15 T C 16: 49,120,057 I790T probably benign Het
Necab1 T G 4: 14,989,248 I176L probably benign Het
Nfkb2 T A 19: 46,309,922 L555Q probably damaging Het
Nhlrc3 T A 3: 53,458,567 E168D probably benign Het
Nlrp5 T A 7: 23,435,778 C949S probably damaging Het
Nup155 C A 15: 8,157,703 A1372E probably benign Het
Nynrin G T 14: 55,863,263 R170L probably damaging Het
Ogfrl1 T A 1: 23,370,321 N275Y probably damaging Het
Olfr1110 C T 2: 87,135,877 S148N probably damaging Het
Olfr1302 A G 2: 111,780,845 D175G probably damaging Het
Olfr1480 A G 19: 13,529,955 N138S probably benign Het
Olfr912 A G 9: 38,581,969 T231A possibly damaging Het
Olr1 A T 6: 129,488,876 S56T probably damaging Het
Ovol2 A T 2: 144,331,283 probably benign Het
Pcdha6 A T 18: 36,969,853 I700F probably damaging Het
Prkcz C T 4: 155,289,702 V86M probably damaging Het
Ptpn13 A G 5: 103,586,773 T2124A probably benign Het
Ranbp3 G T 17: 56,673,346 probably benign Het
Rapgef2 A G 3: 79,169,769 probably benign Het
Rbl1 A G 2: 157,174,804 V625A probably benign Het
Rbm38 G T 2: 173,022,151 G38C probably damaging Het
Reg1 T G 6: 78,426,350 F7C possibly damaging Het
Retnlg A T 16: 48,874,334 Q115L possibly damaging Het
Rhobtb1 G A 10: 69,270,153 V183I probably benign Het
Rims1 T C 1: 22,291,105 Q1186R probably damaging Het
Ryr1 A G 7: 29,095,097 F1246L possibly damaging Het
Samm50 A G 15: 84,210,610 N401S possibly damaging Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Sdk1 A G 5: 141,959,238 D304G probably damaging Het
Skint6 T C 4: 113,236,397 Y183C probably damaging Het
Slamf1 A T 1: 171,777,261 T200S probably benign Het
Slc34a2 C T 5: 53,069,451 R639C probably damaging Het
Smap1 A T 1: 23,853,436 M149K probably benign Het
Sorcs1 T C 19: 50,143,981 probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Strip1 G A 3: 107,626,998 T136I probably benign Het
Tacr1 A T 6: 82,557,072 T360S probably benign Het
Tbc1d14 T A 5: 36,571,256 probably benign Het
Tcaf2 T C 6: 42,628,062 Y596C probably damaging Het
Tspoap1 C T 11: 87,778,443 T1454I possibly damaging Het
Ttc30a2 A C 2: 75,977,576 C197W probably benign Het
Ttn A T 2: 76,914,583 M5374K probably benign Het
Uts2r G A 11: 121,160,879 V190I possibly damaging Het
Vmn1r181 A G 7: 23,984,583 T158A possibly damaging Het
Wdr35 A T 12: 9,018,150 T778S probably benign Het
Xrn1 A T 9: 95,974,744 probably benign Het
Zfp35 A T 18: 24,003,269 K223N probably damaging Het
Zfp764 T C 7: 127,404,771 Q396R probably benign Het
Zfyve1 T C 12: 83,558,647 Y11C probably damaging Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0284:Kiz UTSW 2 146863810 missense probably benign 0.22
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0767:Kiz UTSW 2 146889051 missense probably damaging 1.00
R0866:Kiz UTSW 2 146856053 splice site probably benign
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2055:Kiz UTSW 2 146891283 missense probably benign 0.10
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R6222:Kiz UTSW 2 146891061 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8395:Kiz UTSW 2 146953029 missense possibly damaging 0.79
R8513:Kiz UTSW 2 146870764 critical splice acceptor site probably null
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CCAGCAACAATCTTTATGGGCC -3'
(R):5'- AGTGATGCTGTTCTCTGGAC -3'

Sequencing Primer
(F):5'- CAATCTTTATGGGCCGCCAAATG -3'
(R):5'- GAATGGAGTTCAGCAGACTTTC -3'
Posted On2015-12-21