Incidental Mutation 'R0411:Ncoa3'
ID36639
Institutional Source Beutler Lab
Gene Symbol Ncoa3
Ensembl Gene ENSMUSG00000027678
Gene Namenuclear receptor coactivator 3
SynonymsTRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165992636-166073242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166068543 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1292 (N1292S)
Ref Sequence ENSEMBL: ENSMUSP00000104875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088095] [ENSMUST00000109249] [ENSMUST00000109252]
Predicted Effect probably benign
Transcript: ENSMUST00000088095
AA Change: N1293S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: N1293S

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 1.6e-34 PFAM
Pfam:NCOA_u2 451 564 7.1e-46 PFAM
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 1.6e-32 PFAM
Pfam:DUF4927 714 801 2e-32 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1104 2.1e-27 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1221 1233 N/A INTRINSIC
low complexity region 1243 1263 N/A INTRINSIC
DUF1518 1270 1327 1.08e-21 SMART
low complexity region 1384 1398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109249
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109252
AA Change: N1292S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: N1292S

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 4.1e-34 PFAM
low complexity region 438 467 N/A INTRINSIC
low complexity region 502 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 3.5e-28 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1106 6.6e-29 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
low complexity region 1242 1262 N/A INTRINSIC
DUF1518 1269 1326 1.08e-21 SMART
low complexity region 1383 1397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139658
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Ncoa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ncoa3 APN 2 166051609 splice site probably null
IGL01068:Ncoa3 APN 2 166052795 missense probably damaging 1.00
IGL01300:Ncoa3 APN 2 166068461 missense probably benign 0.41
IGL01336:Ncoa3 APN 2 166054523 missense probably benign
IGL01533:Ncoa3 APN 2 166055025 missense probably benign 0.03
IGL01658:Ncoa3 APN 2 166051302 splice site probably benign
IGL02053:Ncoa3 APN 2 166054834 missense probably damaging 1.00
IGL02138:Ncoa3 APN 2 166055262 missense probably benign
IGL02167:Ncoa3 APN 2 166070136 missense probably damaging 1.00
IGL02217:Ncoa3 APN 2 166055346 missense probably damaging 1.00
IGL02312:Ncoa3 APN 2 166057200 missense probably benign 0.10
IGL02381:Ncoa3 APN 2 166052817 missense probably damaging 1.00
IGL02568:Ncoa3 APN 2 166069357 missense probably damaging 1.00
IGL02658:Ncoa3 APN 2 166051393 missense probably benign 0.01
IGL02806:Ncoa3 APN 2 166052432 missense probably benign 0.25
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0333:Ncoa3 UTSW 2 166054291 missense probably damaging 1.00
R0379:Ncoa3 UTSW 2 166054502 missense probably damaging 0.97
R0734:Ncoa3 UTSW 2 166069191 unclassified probably benign
R1434:Ncoa3 UTSW 2 166055510 missense probably benign 0.01
R1491:Ncoa3 UTSW 2 166055262 missense probably benign
R1721:Ncoa3 UTSW 2 166069301 missense possibly damaging 0.55
R1895:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R1896:Ncoa3 UTSW 2 166048464 missense probably benign 0.36
R1946:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R2406:Ncoa3 UTSW 2 166055359 missense probably damaging 1.00
R3800:Ncoa3 UTSW 2 166059719 missense possibly damaging 0.58
R3825:Ncoa3 UTSW 2 166054798 missense possibly damaging 0.83
R4377:Ncoa3 UTSW 2 166054497 missense possibly damaging 0.50
R4674:Ncoa3 UTSW 2 166059811 missense probably benign
R4706:Ncoa3 UTSW 2 166047879 missense probably damaging 1.00
R4751:Ncoa3 UTSW 2 166069903 missense possibly damaging 0.81
R4954:Ncoa3 UTSW 2 166065786 missense probably benign
R4976:Ncoa3 UTSW 2 166047900 missense probably damaging 1.00
R4992:Ncoa3 UTSW 2 166069939 missense probably benign 0.39
R5100:Ncoa3 UTSW 2 166050097 missense probably damaging 1.00
R5578:Ncoa3 UTSW 2 166054328 missense probably benign 0.00
R5932:Ncoa3 UTSW 2 166070125 splice site probably null
R6051:Ncoa3 UTSW 2 166058765 missense probably damaging 1.00
R6370:Ncoa3 UTSW 2 166065905 missense probably benign 0.00
R6372:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R6373:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R7438:Ncoa3 UTSW 2 166068529 missense probably damaging 1.00
R7660:Ncoa3 UTSW 2 166069321 missense probably benign 0.00
X0018:Ncoa3 UTSW 2 166054802 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AACGAGAGCTGATGAGCCATCACC -3'
(R):5'- ATCACAGTAAGTGCCCAAGTCACAG -3'

Sequencing Primer
(F):5'- TGATGTCACAACCACAGCCT -3'
(R):5'- TCACACTCAACGGAACTGGT -3'
Posted On2013-05-09