Mutagenetix > Incidental Mutations

Incidental Mutation 'R0411:Ncoa3'

36639

Institutional Source

Beutler Lab

Gene Symbol

Ncoa3

Ensembl Gene

ENSMUSG00000027678

Gene Name

nuclear receptor coactivator 3

Synonyms

TRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik

MMRRC Submission

038613-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R0411 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

165992636-166073242 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 166068543 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1292 (N1292S)

Ref Sequence

ENSEMBL: ENSMUSP00000104875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088095] [ENSMUST00000109249] [ENSMUST00000109252]

Predicted Effect

probably benign
Transcript: ENSMUST00000088095
AA Change: N1293S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: N1293S

Domain	Start	End	E-Value	Type
HLH	32	89	5.63e-9	SMART
PAS	113	179	1.16e-11	SMART
Pfam:PAS_11	261	372	1.6e-34	PFAM
Pfam:NCOA_u2	451	564	7.1e-46	PFAM
low complexity region	586	599	N/A	INTRINSIC
Pfam:SRC-1	608	696	1.6e-32	PFAM
Pfam:DUF4927	714	801	2e-32	PFAM
coiled coil region	960	997	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	1056	1104	2.1e-27	PFAM
low complexity region	1180	1197	N/A	INTRINSIC
low complexity region	1221	1233	N/A	INTRINSIC
low complexity region	1243	1263	N/A	INTRINSIC
DUF1518	1270	1327	1.08e-21	SMART
low complexity region	1384	1398	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109249

SMART Domains

Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Sulfatase	44	375	2.8e-50	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	532	670	1.3e-46	PFAM
low complexity region	702	720	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109252
AA Change: N1292S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: N1292S

Domain	Start	End	E-Value	Type
HLH	32	89	5.63e-9	SMART
PAS	113	179	1.16e-11	SMART
Pfam:PAS_11	261	372	4.1e-34	PFAM
low complexity region	438	467	N/A	INTRINSIC
low complexity region	502	522	N/A	INTRINSIC
low complexity region	527	535	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC
Pfam:SRC-1	608	696	3.5e-28	PFAM
coiled coil region	960	997	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	1056	1106	6.6e-29	PFAM
low complexity region	1180	1197	N/A	INTRINSIC
low complexity region	1218	1232	N/A	INTRINSIC
low complexity region	1242	1262	N/A	INTRINSIC
DUF1518	1269	1326	1.08e-21	SMART
low complexity region	1383	1397	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139394

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139658

Meta Mutation Damage Score

0.1141

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	A	G	5: 63,896,491		probably benign	Het
6030469F06Rik	A	T	12: 31,184,731		noncoding transcript	Het
Acad11	T	C	9: 104,116,296	F541L	probably damaging	Het
Acin1	G	T	14: 54,646,774	R92S	probably damaging	Het
Appl1	A	G	14: 26,940,256	S490P	probably benign	Het
Aqp9	C	A	9: 71,130,444	V184L	probably benign	Het
Arih1	A	T	9: 59,485,983	I122N	possibly damaging	Het
Bmi1	T	C	2: 18,683,172		probably benign	Het
Bmpr1a	G	A	14: 34,415,877	T391I	possibly damaging	Het
Cacna1s	A	G	1: 136,113,303	K1256E	probably damaging	Het
Cacng3	C	T	7: 122,768,572	P225L	probably damaging	Het
Cd101	A	T	3: 101,018,527		probably null	Het
Cd55	A	G	1: 130,462,557		probably benign	Het
Cenpe	T	C	3: 135,222,255	I258T	probably damaging	Het
Cma2	A	G	14: 55,973,678		probably benign	Het
Ddost	T	A	4: 138,309,653	S176T	probably benign	Het
Ddx19b	A	T	8: 111,023,964		probably null	Het
Dmxl2	A	G	9: 54,378,939	I2681T	probably damaging	Het
Ern1	C	T	11: 106,398,586	E964K	probably benign	Het
Galntl5	C	T	5: 25,220,174	R430C	probably benign	Het
Gga3	A	G	11: 115,587,433	L511P	probably damaging	Het
Gm7271	G	T	5: 76,500,487	V47L	possibly damaging	Het
Gria2	C	T	3: 80,710,858		probably benign	Het
Hmbs	A	T	9: 44,341,652	L28*	probably null	Het
Iffo2	A	G	4: 139,603,221	E220G	probably damaging	Het
Ifi30	A	G	8: 70,764,918		probably benign	Het
Irf2	T	A	8: 46,846,061	C297S	probably benign	Het
Izumo4	T	C	10: 80,703,084	Y94H	probably damaging	Het
Klhdc9	A	G	1: 171,359,785	V215A	probably benign	Het
Kmt2a	T	C	9: 44,819,964		probably benign	Het
Kmt2c	A	T	5: 25,375,957	C513S	probably damaging	Het
Lyg1	A	T	1: 37,949,896	M81K	possibly damaging	Het
Maip1	T	G	1: 57,415,693	W279G	probably damaging	Het
Myo7a	T	C	7: 98,071,937	T1263A	probably benign	Het
Naa15	T	A	3: 51,465,639	I701N	possibly damaging	Het
Necab2	T	A	8: 119,454,240		probably benign	Het
Nfatc1	T	A	18: 80,698,042	I234F	possibly damaging	Het
Olfm1	G	A	2: 28,208,211	R95K	possibly damaging	Het
Olfr1118	A	G	2: 87,309,058	T90A	probably benign	Het
Olfr1329	A	T	4: 118,916,626	N280K	possibly damaging	Het
Otoa	T	C	7: 121,156,527		probably null	Het
Padi4	GCTGCGTACCTCCAC	GC	4: 140,748,449		probably benign	Het
Pard6g	A	G	18: 80,117,122	D150G	probably damaging	Het
Pax5	A	G	4: 44,609,783	L215S	probably damaging	Het
Pja2	A	T	17: 64,287,521		probably benign	Het
Plk4	T	A	3: 40,811,219		probably benign	Het
Polr1a	A	T	6: 71,978,421	H1687L	possibly damaging	Het
Ptcd2	G	A	13: 99,343,391	L41F	probably damaging	Het
Ropn1	T	A	16: 34,669,964	S62T	probably benign	Het
Setd1a	T	C	7: 127,796,051		probably benign	Het
Setdb1	T	C	3: 95,327,686	D902G	probably damaging	Het
Sik3	T	A	9: 46,208,770	L719Q	probably damaging	Het
Slc36a1	G	T	11: 55,232,507	V433F	probably benign	Het
Slc6a3	T	C	13: 73,557,050	V220A	possibly damaging	Het
Slc6a5	A	T	7: 49,911,791	R24W	probably damaging	Het
Smox	G	T	2: 131,520,644	R281L	probably benign	Het
Sulf2	G	T	2: 166,093,516	H226N	probably damaging	Het
Syne2	C	T	12: 76,059,584		probably null	Het
Tenm3	C	T	8: 48,287,791	S1210N	possibly damaging	Het
Tns1	A	T	1: 73,925,761	V1237E	probably damaging	Het
Trf	C	T	9: 103,217,501	V92M	probably damaging	Het
Ttn	A	G	2: 76,709,373	V34423A	possibly damaging	Het
Vmn2r118	A	G	17: 55,611,021		probably benign	Het
Vmn2r19	A	G	6: 123,309,744	Y112C	probably damaging	Het
Wdr66	C	T	5: 123,290,054	T538M	probably damaging	Het
Zfp326	G	T	5: 105,878,775	A15S	possibly damaging	Het

Other mutations in Ncoa3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Ncoa3	APN	2	166051609	splice site	probably null
IGL01068:Ncoa3	APN	2	166052795	missense	probably damaging	1.00
IGL01300:Ncoa3	APN	2	166068461	missense	probably benign	0.41
IGL01336:Ncoa3	APN	2	166054523	missense	probably benign
IGL01533:Ncoa3	APN	2	166055025	missense	probably benign	0.03
IGL01658:Ncoa3	APN	2	166051302	splice site	probably benign
IGL02053:Ncoa3	APN	2	166054834	missense	probably damaging	1.00
IGL02138:Ncoa3	APN	2	166055262	missense	probably benign
IGL02167:Ncoa3	APN	2	166070136	missense	probably damaging	1.00
IGL02217:Ncoa3	APN	2	166055346	missense	probably damaging	1.00
IGL02312:Ncoa3	APN	2	166057200	missense	probably benign	0.10
IGL02381:Ncoa3	APN	2	166052817	missense	probably damaging	1.00
IGL02568:Ncoa3	APN	2	166069357	missense	probably damaging	1.00
IGL02658:Ncoa3	APN	2	166051393	missense	probably benign	0.01
IGL02806:Ncoa3	APN	2	166052432	missense	probably benign	0.25
R0054:Ncoa3	UTSW	2	166055178	missense	possibly damaging	0.67
R0054:Ncoa3	UTSW	2	166055178	missense	possibly damaging	0.67
R0240:Ncoa3	UTSW	2	166054400	missense	probably benign
R0240:Ncoa3	UTSW	2	166054400	missense	probably benign
R0333:Ncoa3	UTSW	2	166054291	missense	probably damaging	1.00
R0379:Ncoa3	UTSW	2	166054502	missense	probably damaging	0.97
R0734:Ncoa3	UTSW	2	166069191	unclassified	probably benign
R1434:Ncoa3	UTSW	2	166055510	missense	probably benign	0.01
R1491:Ncoa3	UTSW	2	166055262	missense	probably benign
R1721:Ncoa3	UTSW	2	166069301	missense	possibly damaging	0.55
R1895:Ncoa3	UTSW	2	166059177	missense	possibly damaging	0.68
R1896:Ncoa3	UTSW	2	166048464	missense	probably benign	0.36
R1946:Ncoa3	UTSW	2	166059177	missense	possibly damaging	0.68
R2406:Ncoa3	UTSW	2	166055359	missense	probably damaging	1.00
R3800:Ncoa3	UTSW	2	166059719	missense	possibly damaging	0.58
R3825:Ncoa3	UTSW	2	166054798	missense	possibly damaging	0.83
R4377:Ncoa3	UTSW	2	166054497	missense	possibly damaging	0.50
R4674:Ncoa3	UTSW	2	166059811	missense	probably benign
R4706:Ncoa3	UTSW	2	166047879	missense	probably damaging	1.00
R4751:Ncoa3	UTSW	2	166069903	missense	possibly damaging	0.81
R4954:Ncoa3	UTSW	2	166065786	missense	probably benign
R4976:Ncoa3	UTSW	2	166047900	missense	probably damaging	1.00
R4992:Ncoa3	UTSW	2	166069939	missense	probably benign	0.39
R5100:Ncoa3	UTSW	2	166050097	missense	probably damaging	1.00
R5578:Ncoa3	UTSW	2	166054328	missense	probably benign	0.00
R5932:Ncoa3	UTSW	2	166070125	splice site	probably null
R6051:Ncoa3	UTSW	2	166058765	missense	probably damaging	1.00
R6370:Ncoa3	UTSW	2	166065905	missense	probably benign	0.00
R6372:Ncoa3	UTSW	2	166059347	missense	possibly damaging	0.94
R6373:Ncoa3	UTSW	2	166059347	missense	possibly damaging	0.94
R7438:Ncoa3	UTSW	2	166068529	missense	probably damaging	1.00
R7660:Ncoa3	UTSW	2	166069321	missense	probably benign	0.00
R7738:Ncoa3	UTSW	2	166050067	missense	probably damaging	1.00
R7752:Ncoa3	UTSW	2	166065768	nonsense	probably null
X0018:Ncoa3	UTSW	2	166054802	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- AACGAGAGCTGATGAGCCATCACC -3'
(R):5'- ATCACAGTAAGTGCCCAAGTCACAG -3'

Sequencing Primer
(F):5'- TGATGTCACAACCACAGCCT -3'
(R):5'- TCACACTCAACGGAACTGGT -3'

Posted On

2013-05-09